BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17559

Title: Assignment of the stem loop 2 of RsmZ   PubMed: 22252483

Deposition date: 2011-03-31 Original release date: 2012-01-24

Authors: Schubert, Mario; Aeschbacher, Thomas; Duss, Olivier; Allain, Frederic

Citation: Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic H-T. "A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets."  J. Biomol. NMR 52, 179-190 (2012).

Assembly members:
FZL2, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: g-proteobacteria   Taxonomy ID: 294   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Pseudomonas fluorescens

Experimental source:   Production method: cell free synthesis   Host organism: not applicable

Entity Sequences (FASTA):
FZL2: GGGCCAUCAAGGACGAUGGU CC

Data sets:
Data typeCount
13C chemical shifts59
1H chemical shifts59

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1FZL2 (monomer)1

Entities:

Entity 1, FZL2 (monomer) 22 residues - Formula weight is not available

1   GGGCCAUCAA
2   GGACGAUGGU
3   CC

Samples:

sample_1: FZL2 2 mM; D2O 100%

sample_2: FZL2 2 mM; D2O 5%; H2O 95%

sample_conditions_1: ionic strength: 0 M; pH: 7.4; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection, refinement

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 500 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 900 MHz