data_30257
#######################
# Entry information #
#######################
save_entry_information
_Saveframe_category entry_information
_Entry_title
;
Structure of wild type pre-miR21 apical loop
;
_BMRB_accession_number 30257
_BMRB_flat_file_name bmr30257.str
_Entry_type original
_Submission_date 2017-02-27
_Accession_date 2017-02-27
_Entry_origination author
_NMR_STAR_version 2.1.1
_Experimental_method NMR
_Details .
loop_
_Author_ordinal
_Author_family_name
_Author_given_name
_Author_middle_initials
_Author_family_title
1 Shortridge M. D. .
2 Varani G. . .
stop_
loop_
_Saveframe_category_type
_Saveframe_category_type_count
assigned_chemical_shifts 1
stop_
loop_
_Data_type
_Data_type_count
"1H chemical shifts" 180
"13C chemical shifts" 129
stop_
loop_
_Revision_date
_Revision_keyword
_Revision_author
_Revision_detail
2018-03-15 update BMRB 'update entry citation'
2017-06-08 original author 'original release'
stop_
_Original_release_date 2017-05-02
save_
#############################
# Citation for this entry #
#############################
save_citation_1
_Saveframe_category entry_citation
_Citation_full .
_Citation_title
;
A macrocyclic peptide ligand binds the oncogenic microRNA-21 precursor and suppresses Dicer processing.
;
_Citation_status published
_Citation_type journal
_CAS_abstract_code .
_MEDLINE_UI_code .
_PubMed_ID 28437065
loop_
_Author_ordinal
_Author_family_name
_Author_given_name
_Author_middle_initials
_Author_family_title
1 Shortridge M. D. .
2 Walker M. J. .
3 Pavelitz T. . .
4 Chen Y. . .
5 Yang W. . .
6 Varani G. . .
stop_
_Journal_abbreviation 'ACS Chem. Biol.'
_Journal_volume 12
_Journal_issue 6
_Journal_ISSN 1554-8937
_Journal_CSD .
_Book_chapter_title .
_Book_volume .
_Book_series .
_Book_ISBN .
_Conference_state_province .
_Conference_abstract_number .
_Page_first 1611
_Page_last 1620
_Year 2017
_Details .
save_
##################################
# Molecular system description #
##################################
save_assembly
_Saveframe_category molecular_system
_Mol_system_name pre-miR-21
_Enzyme_commission_number .
loop_
_Mol_system_component_name
_Mol_label
entity_1 $entity_1
stop_
_System_molecular_weight .
_System_oligomer_state ?
_System_paramagnetic no
_System_thiol_state .
_Database_query_date .
_Details .
save_
########################
# Monomeric polymers #
########################
save_entity_1
_Saveframe_category monomeric_polymer
_Mol_type polymer
_Mol_polymer_class RNA
_Name_common entity_1
_Molecular_mass 9912.896
_Mol_thiol_state 'not present'
_Details .
##############################
# Polymer residue sequence #
##############################
_Residue_count 31
_Mol_residue_sequence
;
GGUGUUGACUGUUGAAUCUC
AUGGCAACACC
;
loop_
_Residue_seq_code
_Residue_author_seq_code
_Residue_label
1 22 G 2 23 G 3 24 U 4 25 G 5 26 U
6 27 U 7 28 G 8 29 A 9 30 C 10 31 U
11 32 G 12 33 U 13 34 U 14 35 G 15 36 A
16 37 A 17 38 U 18 39 C 19 40 U 20 41 C
21 42 A 22 43 U 23 44 G 24 45 G 25 46 C
26 47 A 27 48 A 28 49 C 29 50 A 30 51 C
31 52 C
stop_
_Sequence_homology_query_date .
_Sequence_homology_query_revised_last_date .
save_
####################
# Natural source #
####################
save_natural_source
_Saveframe_category natural_source
loop_
_Mol_label
_Organism_name_common
_NCBI_taxonomy_ID
_Superkingdom
_Kingdom
_Genus
_Species
$entity_1 Human 9606 Eukaryota Metazoa Homo sapiens
stop_
save_
#########################
# Experimental source #
#########################
save_experimental_source
_Saveframe_category experimental_source
loop_
_Mol_label
_Production_method
_Host_organism_name_common
_Genus
_Species
_Strain
_Vector_name
$entity_1 'chemical synthesis' . . . . .
stop_
save_
#####################################
# Sample contents and methodology #
#####################################
########################
# Sample description #
########################
save_sample_1
_Saveframe_category sample
_Sample_type solution
_Details
;
1.1 mM pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride,
0.01 mM EDTA, 95% H2O/5% D2O.
;
loop_
_Mol_label
_Concentration_value
_Concentration_value_units
_Isotopic_labeling
EDTA 0.01 mM 'natural abundance'
'potassium phosphate' 10 mM 'natural abundance'
$entity_1 1.1 mM 'natural abundance'
'sodium chloride' 10 mM 'natural abundance'
stop_
save_
save_sample_2
_Saveframe_category sample
_Sample_type solution
_Details '1.1 mM pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 mM EDTA, 100% D2O.'
loop_
_Mol_label
_Concentration_value
_Concentration_value_units
_Isotopic_labeling
EDTA 0.01 mM 'natural abundance'
'potassium phosphate' 10 mM 'natural abundance'
$entity_1 1.1 mM 'natural abundance'
'sodium chloride' 10 mM 'natural abundance'
stop_
save_
save_sample_3
_Saveframe_category sample
_Sample_type solution
_Details '0.5 mM [U-99% 13C; U-99% 15N] pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 mM EDTA, 100% D2O.'
loop_
_Mol_label
_Concentration_value
_Concentration_value_units
_Isotopic_labeling
EDTA 0.01 mM 'natural abundance'
'potassium phosphate' 10 mM 'natural abundance'
$entity_1 0.5 mM '[U-99% 13C; U-99% 15N]'
'sodium chloride' 10 mM 'natural abundance'
stop_
save_
save_sample_4
_Saveframe_category sample
_Sample_type solution
_Details '0.5 mM [U-99% 13C; U-99% 15N] pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 g/L EDTA, 95% H2O/5% D2O.'
loop_
_Mol_label
_Concentration_value
_Concentration_value_units
_Isotopic_labeling
EDTA 0.01 g/L 'natural abundance'
'potassium phosphate' 10 mM 'natural abundance'
$entity_1 0.5 mM '[U-99% 13C; U-99% 15N]'
'sodium chloride' 10 mM 'natural abundance'
stop_
save_
############################
# Computer software used #
############################
save_software_1
_Saveframe_category software
_Name Analysis
_Version .
loop_
_Vendor
_Address
_Electronic_address
CCPN . .
stop_
loop_
_Task
'chemical shift assignment'
stop_
_Details .
save_
save_software_2
_Saveframe_category software
_Name NMRPipe
_Version .
loop_
_Vendor
_Address
_Electronic_address
'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . .
stop_
loop_
_Task
processing
stop_
_Details .
save_
save_software_3
_Saveframe_category software
_Name SPARKY
_Version .
loop_
_Vendor
_Address
_Electronic_address
Goddard . .
stop_
loop_
_Task
'chemical shift assignment'
stop_
_Details .
save_
save_software_4
_Saveframe_category software
_Name TOPSPIN
_Version .
loop_
_Vendor
_Address
_Electronic_address
'Bruker Biospin' . .
stop_
loop_
_Task
processing
stop_
_Details .
save_
save_software_5
_Saveframe_category software
_Name 'X-PLOR NIH'
_Version .
loop_
_Vendor
_Address
_Electronic_address
'Schwieters, Kuszewski, Tjandra and Clore' . .
stop_
loop_
_Task
refinement
stop_
_Details .
save_
#########################
# Experimental detail #
#########################
##################################
# NMR Spectrometer definitions #
##################################
save_NMR_spectrometer_1
_Saveframe_category NMR_spectrometer
_Manufacturer Bruker
_Model DRX
_Field_strength 500
_Details .
save_
save_NMR_spectrometer_2
_Saveframe_category NMR_spectrometer
_Manufacturer Bruker
_Model AvanceIII
_Field_strength 800
_Details .
save_
#############################
# NMR applied experiments #
#############################
save_2D_1H-1H_NOESY_1
_Saveframe_category NMR_applied_experiment
_Experiment_name '2D 1H-1H NOESY'
_Sample_label $sample_1
save_
save_3D_1H-13C_NOESY_2
_Saveframe_category NMR_applied_experiment
_Experiment_name '3D 1H-13C NOESY'
_Sample_label $sample_3
save_
save_2D_1H-1H_TOCSY_3
_Saveframe_category NMR_applied_experiment
_Experiment_name '2D 1H-1H TOCSY'
_Sample_label $sample_2
save_
save_2D_1H-15N_HSQC_4
_Saveframe_category NMR_applied_experiment
_Experiment_name '2D 1H-15N HSQC'
_Sample_label $sample_4
save_
save_3D_1H-15N_NOESY_5
_Saveframe_category NMR_applied_experiment
_Experiment_name '3D 1H-15N NOESY'
_Sample_label $sample_4
save_
save_2D_1H-1H_NOESY_6
_Saveframe_category NMR_applied_experiment
_Experiment_name '2D 1H-1H NOESY'
_Sample_label $sample_2
save_
#######################
# Sample conditions #
#######################
save_sample_conditions_1
_Saveframe_category sample_conditions
_Details .
loop_
_Variable_type
_Variable_value
_Variable_value_error
_Variable_value_units
'ionic strength' 10 . mM
pH 6.5 . pH
pressure 1 . atm
temperature 278 . K
stop_
save_
save_sample_conditions_2
_Saveframe_category sample_conditions
_Details .
loop_
_Variable_type
_Variable_value
_Variable_value_error
_Variable_value_units
'ionic strength' 10 . mM
pH 6.5 . pH
pressure 1 . atm
temperature 310 . K
stop_
save_
####################
# NMR parameters #
####################
##############################
# Assigned chemical shifts #
##############################
################################
# Chemical shift referencing #
################################
save_chem_shift_reference_1
_Saveframe_category chemical_shift_reference
_Details .
loop_
_Mol_common_name
_Atom_type
_Atom_isotope_number
_Atom_group
_Chem_shift_units
_Chem_shift_value
_Reference_method
_Reference_type
_External_reference_sample_geometry
_External_reference_location
_External_reference_axis
_Indirect_shift_ratio
DSS C 13 'methyl protons' ppm 0.000 internal indirect . . . 0.25144953
DSS H 1 'methyl protons' ppm 0.000 internal direct . . . 1.0
DSS N 15 'methyl protons' ppm 0.000 internal indirect . . . 0.10132912
stop_
save_
###################################
# Assigned chemical shift lists #
###################################
###################################################################
# Chemical Shift Ambiguity Index Value Definitions #
# #
# The values other than 1 are used for those atoms with different #
# chemical shifts that cannot be assigned to stereospecific atoms #
# or to specific residues or chains. #
# #
# Index Value Definition #
# #
# 1 Unique (including isolated methyl protons, #
# geminal atoms, and geminal methyl #
# groups with identical chemical shifts) #
# (e.g. ILE HD11, HD12, HD13 protons) #
# 2 Ambiguity of geminal atoms or geminal methyl #
# proton groups (e.g. ASP HB2 and HB3 #
# protons, LEU CD1 and CD2 carbons, or #
# LEU HD11, HD12, HD13 and HD21, HD22, #
# HD23 methyl protons) #
# 3 Aromatic atoms on opposite sides of #
# symmetrical rings (e.g. TYR HE1 and HE2 #
# protons) #
# 4 Intraresidue ambiguities (e.g. LYS HG and #
# HD protons or TRP HZ2 and HZ3 protons) #
# 5 Interresidue ambiguities (LYS 12 vs. LYS 27) #
# 6 Intermolecular ambiguities (e.g. ASP 31 CA #
# in monomer 1 and ASP 31 CA in monomer 2 #
# of an asymmetrical homodimer, duplex #
# DNA assignments, or other assignments #
# that may apply to atoms in one or more #
# molecule in the molecular assembly) #
# 9 Ambiguous, specific ambiguity not defined #
# #
###################################################################
save_assigned_chemical_shifts_1
_Saveframe_category assigned_chemical_shifts
_Details .
loop_
_Experiment_label
'2D 1H-1H NOESY'
'3D 1H-13C NOESY'
'2D 1H-1H TOCSY'
'2D 1H-15N HSQC'
'3D 1H-15N NOESY'
stop_
loop_
_Sample_label
$sample_1
$sample_3
$sample_2
$sample_4
stop_
_Sample_conditions_label $sample_conditions_1
_Chem_shift_reference_set_label $chem_shift_reference_1
_Mol_system_component_name entity_1
_Text_data_format .
_Text_data .
loop_
_Atom_shift_assign_ID
_Residue_author_seq_code
_Residue_seq_code
_Residue_label
_Atom_name
_Atom_type
_Chem_shift_value
_Chem_shift_value_error
_Chem_shift_ambiguity_code
1 22 1 G H1' H 5.83 . .
2 22 1 G H3' H 4.73 . .
3 22 1 G H4' H 4.51 . .
4 22 1 G H5' H 4.46 . .
5 22 1 G H5'' H 4.28 . .
6 22 1 G H8 H 8.24 . .
7 22 1 G C1' C 89.91 . .
8 22 1 G C2' C 72.42 . .
9 22 1 G C3' C 70.15 . .
10 22 1 G C4' C 80.53 . .
11 22 1 G C5' C 63.72 . .
12 22 1 G C8 C 136.84 . .
13 22 1 G HO2' H 4.95 . .
14 23 2 G H1 H 13.39 . .
15 23 2 G H1' H 5.9 . .
16 23 2 G H3' H 4.58 . .
17 23 2 G H4' H 4.53 . .
18 23 2 G H5' H 4.52 . .
19 23 2 G H5'' H 4.19 . .
20 23 2 G H8 H 7.62 . .
21 23 2 G H21 H 6.33 . .
22 23 2 G C1' C 90.57 . .
23 23 2 G C2' C 72.74 . .
24 23 2 G C3' C 70.23 . .
25 23 2 G C4' C 79.82 . .
26 23 2 G C5' C 62.89 . .
27 23 2 G C8 C 134.47 . .
28 23 2 G HO2' H 4.49 . .
29 24 3 U H1' H 5.57 . .
30 24 3 U H3 H 13.74 . .
31 24 3 U H3' H 4.56 . .
32 24 3 U H4' H 4.47 . .
33 24 3 U H5 H 5.14 . .
34 24 3 U H5' H 4.57 . .
35 24 3 U H5'' H 4.12 . .
36 24 3 U H6 H 7.72 . .
37 24 3 U C1' C 90.89 . .
38 24 3 U C2' C 72.77 . .
39 24 3 U C3' C 69.8 . .
40 24 3 U C4' C 79.35 . .
41 24 3 U C5 C 100.4 . .
42 24 3 U C5' C 62.1 . .
43 24 3 U C6 C 138.58 . .
44 24 3 U HO2' H 4.69 . .
45 25 4 G H1 H 12.61 . .
46 25 4 G H1' H 5.76 . .
47 25 4 G H3' H 4.5 . .
48 25 4 G H4' H 4.49 . .
49 25 4 G H5' H 4.47 . .
50 25 4 G H5'' H 4.15 . .
51 25 4 G H8 H 7.69 . .
52 25 4 G H21 H 6.51 . .
53 25 4 G C1' C 90.3 . .
54 25 4 G C2' C 72.8 . .
55 25 4 G C3' C 70.94 . .
56 25 4 G C4' C 79.49 . .
57 25 4 G C5' C 63.62 . .
58 25 4 G C8 C 133.76 . .
59 25 4 G HO2' H 4.46 . .
60 26 5 U H1' H 5.45 . .
61 26 5 U H3 H 14.3 . .
62 26 5 U H3' H 4.45 . .
63 26 5 U H4' H 4.42 . .
64 26 5 U H5 H 5.04 . .
65 26 5 U H5' H 4.58 . .
66 26 5 U H5'' H 4.14 . .
67 26 5 U H6 H 7.76 . .
68 26 5 U C1' C 91.22 . .
69 26 5 U C2' C 72.521 . .
70 26 5 U C3' C 69.55 . .
71 26 5 U C4' C 79.63 . .
72 26 5 U C5 C 99.9 . .
73 26 5 U C5' C 62.03 . .
74 26 5 U C6 C 139.276 . .
75 26 5 U HO2' H 4.43 . .
76 27 6 U H1' H 5.6 . .
77 27 6 U H3 H 13.12 . .
78 27 6 U H3' H 4.7 . .
79 27 6 U H4' H 4.56 . .
80 27 6 U H5 H 5.554 . .
81 27 6 U H5'' H 4.15 . .
82 27 6 U H6 H 7.93 . .
83 27 6 U C1' C 90.71 . .
84 27 6 U C2' C 72.95 . .
85 27 6 U C3' C 69.8 . .
86 27 6 U C4' C 79.35 . .
87 27 6 U C5 C 101.2 . .
88 27 6 U C5' C 62.01 . .
89 27 6 U C6 C 139.24 . .
90 27 6 U HO2' H 4.52 . .
91 28 7 G H1 H 11.77 . .
92 28 7 G H1' H 5.68 . .
93 28 7 G H8 H 7.7 . .
94 28 7 G H21 H 7.22 . .
95 28 7 G H22 H 5.96 . .
96 28 7 G C1' C 89.79 . .
97 28 7 G C2' C 73.14 . .
98 28 7 G C8 C 134.33 . .
99 28 7 G HO2' H 4.41 . .
100 29 8 A H1' H 5.94 . .
101 29 8 A H2 H 8.06 . .
102 29 8 A H8 H 8.13 . .
103 29 8 A H61 H 10.4 . .
104 29 8 A H62 H 9.08 . .
105 29 8 A C1' C 88.96 . .
106 29 8 A C8 C 138.46 . .
107 29 8 A HO2' H 4.6 . .
108 30 9 C H5 H 5.32 . .
109 30 9 C H6 H 7.33 . .
110 31 10 U H1' H 5.376 . .
111 31 10 U H5 H 5.47 . .
112 31 10 U H6 H 7.6 . .
113 31 10 U C1' C 90.45 . .
114 31 10 U C5 C 101.38 . .
115 31 10 U C6 C 139.43 . .
116 31 10 U HO2' H 4.41 . .
117 32 11 G H4' H 4.28 . .
118 32 11 G H8 H 7.74 . .
119 32 11 G C1' C 88.95 . .
120 32 11 G C2' C 72.98 . .
121 32 11 G C4' C 81.67 . .
122 32 11 G C8 C 134.54 . .
123 32 11 G HO2' H 4.54 . .
124 33 12 U H1' H 5.65 . .
125 33 12 U H5 H 5.65 . .
126 33 12 U H6 H 7.706 . .
127 33 12 U C1' C 88.8 . .
128 33 12 U C5 C 102.35 . .
129 33 12 U C6 C 140.59 . .
130 33 12 U HO2' H 4.26 . .
131 34 13 U H1' H 5.64 . .
132 34 13 U H4' H 4.31 . .
133 34 13 U H5 H 5.54 . .
134 34 13 U H6 H 7.64 . .
135 34 13 U C1' C 87.52 . .
136 34 13 U C4' C 81.84 . .
137 34 13 U C5 C 102.139 . .
138 34 13 U C6 C 140.36 . .
139 34 13 U HO2' H 4.505 . .
140 35 14 G H1' H 5.63 . .
141 35 14 G H4' H 4.36 . .
142 35 14 G H8 H 7.82 . .
143 35 14 G C1' C 88.13 . .
144 35 14 G C4' C 81.74 . .
145 35 14 G C8 C 135.51 . .
146 35 14 G HO2' H 4.66 . .
147 36 15 A H1' H 5.83 . .
148 36 15 A H2 H 7.94 . .
149 36 15 A H4' H 4.47 . .
150 36 15 A H8 H 8.14 . .
151 36 15 A C1' C 87.97 . .
152 36 15 A C4' C 82.32 . .
153 36 15 A C8 C 139.14 . .
154 36 15 A HO2' H 4.64 . .
155 37 16 A H1' H 5.65 . .
156 37 16 A H2 H 7.824 . .
157 37 16 A H8 H 7.82 . .
158 37 16 A C1' C 88.59 . .
159 37 16 A C2' C 73.05 . .
160 37 16 A C8 C 136.84 . .
161 37 16 A HO2' H 4.29 . .
162 38 17 U H1' H 5.77 . .
163 38 17 U H4' H 4.39 . .
164 38 17 U H5 H 5.68 . .
165 38 17 U H6 H 7.69 . .
166 38 17 U C1' C 88.22 . .
167 38 17 U C2' C 73.94 . .
168 38 17 U C4' C 82.6 . .
169 38 17 U C5 C 102.47 . .
170 38 17 U C6 C 140.9 . .
171 38 17 U HO2' H 4.55 . .
172 39 18 C H1' H 5.84 . .
173 39 18 C H5 H 5.91 . .
174 39 18 C H6 H 7.76 . .
175 39 18 C C1' C 89.24 . .
176 39 18 C C2' C 73.39 . .
177 39 18 C C5 C 96.17 . .
178 39 18 C C6 C 141.38 . .
179 39 18 C HO2' H 4.34 . .
180 40 19 U H1' H 5.78 . .
181 40 19 U H3' H 4.51 . .
182 40 19 U H5 H 5.79 . .
183 40 19 U H6 H 7.81 . .
184 40 19 U C1' C 88.83 . .
185 40 19 U C2' C 72.78 . .
186 40 19 U C5 C 102.42 . .
187 40 19 U C6 C 140.91 . .
188 40 19 U HO2' H 4.4 . .
189 41 20 C H1' H 5.69 . .
190 41 20 C H4' H 4.41 . .
191 41 20 C H5 H 5.86 . .
192 41 20 C H6 H 7.7 . .
193 41 20 C C1' C 90.34 . .
194 41 20 C C2' C 73.58 . .
195 41 20 C C4' C 80.95 . .
196 41 20 C C5 C 95.91 . .
197 41 20 C C6 C 140.56 . .
198 41 20 C HO2' H 4.67 . .
199 42 21 A H1' H 5.85 . .
200 42 21 A H2 H 7.53 . .
201 42 21 A H8 H 8.14 . .
202 42 21 A C1' C 87.73 . .
203 42 21 A C8 C 139.08 . .
204 43 22 U H5 H 5.53 . .
205 43 22 U H6 H 7.68 . .
206 44 23 G H8 H 7.74 . .
207 44 23 G HO2' H 4.67 . .
208 45 24 G H1' H 5.85 . .
209 45 24 G H8 H 8.14 . .
210 45 24 G C1' C 90.07 . .
211 45 24 G C2' C 72.22 . .
212 45 24 G C8 C 138.99 . .
213 45 24 G HO2' H 4.53 . .
214 46 25 C H5 H 5.25 . .
215 46 25 C H6 H 7.61 . .
216 46 25 C H41 H 8.37 . .
217 46 25 C H42 H 7.08 . .
218 47 26 A H1' H 5.76 . .
219 47 26 A H2 H 6.63 . .
220 47 26 A H3' H 4.75 . .
221 47 26 A H8 H 7.98 . .
222 47 26 A H61 H 7.82 . .
223 47 26 A H62 H 6.43 . .
224 47 26 A C1' C 90.22 . .
225 47 26 A C2 C 149.62 . .
226 47 26 A C2' C 72.98 . .
227 47 26 A C3' C 70.15 . .
228 47 26 A C8 C 137.01 . .
229 47 26 A HO2' H 4.47 . .
230 48 27 A H1' H 5.84 . .
231 48 27 A H2 H 7.58 . .
232 48 27 A H3' H 4.63 . .
233 48 27 A H4' H 4.46 . .
234 48 27 A H5' H 4.58 . .
235 48 27 A H5'' H 4.12 . .
236 48 27 A H8 H 7.87 . .
237 48 27 A H61 H 8.03 . .
238 48 27 A H62 H 6.7 . .
239 48 27 A C1' C 89.87 . .
240 48 27 A C2 C 151.25 . .
241 48 27 A C2' C 73.01 . .
242 48 27 A C3' C 69.88 . .
243 48 27 A C4' C 79.18 . .
244 48 27 A C5' C 61.98 . .
245 48 27 A C8 C 136.57 . .
246 48 27 A HO2' H 4.32 . .
247 49 28 C H1' H 5.28 . .
248 49 28 C H3' H 4.44 . .
249 49 28 C H4' H 4.36 . .
250 49 28 C H5 H 5.17 . .
251 49 28 C H5' H 4.47 . .
252 49 28 C H5'' H 4.04 . .
253 49 28 C H6 H 7.44 . .
254 49 28 C H41 H 8.27 . .
255 49 28 C H42 H 7 . .
256 49 28 C C1' C 90.63 . .
257 49 28 C C2' C 72.82 . .
258 49 28 C C3' C 69.59 . .
259 49 28 C C4' C 79.04 . .
260 49 28 C C5 C 94.8 . .
261 49 28 C C5' C 61.9 . .
262 49 28 C C6 C 137.69 . .
263 49 28 C HO2' H 4.19 . .
264 50 29 A H1' H 5.89 . .
265 50 29 A H2 H 7.42 . .
266 50 29 A H3' H 4.64 . .
267 50 29 A H4' H 4.44 . .
268 50 29 A H8 H 8 . .
269 50 29 A H61 H 8.06 . .
270 50 29 A H62 H 6.36 . .
271 50 29 A C1' C 90.29 . .
272 50 29 A C2 C 151.02 . .
273 50 29 A C2' C 72.87 . .
274 50 29 A C3' C 70.01 . .
275 50 29 A C4' C 79.35 . .
276 50 29 A C8 C 136.92 . .
277 50 29 A HO2' H 4.49 . .
278 51 30 C H1' H 5.39 . .
279 51 30 C H3' H 4.35 . .
280 51 30 C H4' H 4.36 . .
281 51 30 C H5 H 5.18 . .
282 51 30 C H5' H 4.48 . .
283 51 30 C H5'' H 4.03 . .
284 51 30 C H6 H 7.49 . .
285 51 30 C H41 H 8.39 . .
286 51 30 C H42 H 7.08 . .
287 51 30 C C1' C 91.23 . .
288 51 30 C C2' C 73.2 . .
289 51 30 C C3' C 69.6 . .
290 51 30 C C4' C 79.28 . .
291 51 30 C C5 C 94.4 . .
292 51 30 C C5' C 61.96 . .
293 51 30 C C6 C 138.125 . .
294 51 30 C HO2' H 4.1 . .
295 52 31 C H1' H 5.73 . .
296 52 31 C H3' H 4.13 . .
297 52 31 C H4' H 4.13 . .
298 52 31 C H5 H 5.46 . .
299 52 31 C H5' H 4.44 . .
300 52 31 C H5'' H 4.01 . .
301 52 31 C H6 H 7.64 . .
302 52 31 C C1' C 90.24 . .
303 52 31 C C2' C 74.8 . .
304 52 31 C C3' C 67.26 . .
305 52 31 C C4' C 80.9 . .
306 52 31 C C5 C 95.5 . .
307 52 31 C C5' C 62.56 . .
308 52 31 C C6 C 139.32 . .
309 52 31 C HO2' H 3.97 . .
stop_
save_