data_5834
#######################
# Entry information #
#######################
save_entry_information
_Saveframe_category entry_information
_Entry_title
;
Solution structure of the HIV-1 frameshift inducing stem-loop RNA
;
_BMRB_accession_number 5834
_BMRB_flat_file_name bmr5834.str
_Entry_type original
_Submission_date 2003-06-17
_Accession_date 2003-06-17
_Entry_origination author
_NMR_STAR_version 2.1.1
_Experimental_method NMR
_Details .
loop_
_Author_ordinal
_Author_family_name
_Author_given_name
_Author_middle_initials
_Author_family_title
1 Staple David W. .
2 Butcher Samuel E. .
stop_
loop_
_Saveframe_category_type
_Saveframe_category_type_count
assigned_chemical_shifts 1
stop_
loop_
_Data_type
_Data_type_count
"1H chemical shifts" 155
"13C chemical shifts" 59
"15N chemical shifts" 31
stop_
loop_
_Revision_date
_Revision_keyword
_Revision_author
_Revision_detail
2003-09-12 original author .
stop_
_Original_release_date 2003-09-12
save_
#############################
# Citation for this entry #
#############################
save_entry_citation
_Saveframe_category entry_citation
_Citation_full .
_Citation_title 'Solution Structure of the HIV-1 Frameshift Inducing Stem-loop RNA'
_Citation_status published
_Citation_type journal
_CAS_abstract_code .
_MEDLINE_UI_code 22770795
_PubMed_ID 12888491
loop_
_Author_ordinal
_Author_family_name
_Author_given_name
_Author_middle_initials
_Author_family_title
1 Staple David W .
2 Butcher Samuel E .
stop_
_Journal_abbreviation 'Nucleic Acids Res.'
_Journal_volume 31
_Journal_issue 15
_Journal_CSD .
_Book_chapter_title .
_Book_volume .
_Book_series .
_Book_ISBN .
_Conference_state_province .
_Conference_abstract_number .
_Page_first 4326
_Page_last 4331
_Year 2003
_Details .
loop_
_Keyword
frameshift
HIV
RNA
tetraloop
stop_
save_
##################################
# Molecular system description #
##################################
save_system_HIVFSL
_Saveframe_category molecular_system
_Mol_system_name 'HIV-1 frameshift inducing stem-loop RNA'
_Abbreviation_common HIVfsl
_Enzyme_commission_number .
loop_
_Mol_system_component_name
_Mol_label
'HIV-1 frameshift inducing stem-loop RNA' $HIVfsl
stop_
_System_molecular_weight .
_System_physical_state native
_System_oligomer_state monmer
_System_paramagnetic no
_System_thiol_state 'not present'
loop_
_Biological_function
'induces a programmed -1 frameshift during translation of the HIV-1 genes'
stop_
_Database_query_date .
_Details .
save_
########################
# Monomeric polymers #
########################
save_HIVfsl
_Saveframe_category monomeric_polymer
_Mol_type polymer
_Mol_polymer_class RNA
_Name_common 'HIV-1 frameshift inducing stem-loop RNA'
_Abbreviation_common HIVfsl
_Molecular_mass .
_Mol_thiol_state 'not present'
_Details .
##############################
# Polymer residue sequence #
##############################
_Residue_count 22
_Mol_residue_sequence
;
GGCCUUCCCACAAGGGAAGG
CC
;
loop_
_Residue_seq_code
_Residue_label
1 G 2 G 3 C 4 C 5 U
6 U 7 C 8 C 9 C 10 A
11 C 12 A 13 A 14 G 15 G
16 G 17 A 18 A 19 G 20 G
21 C 22 C
stop_
_Sequence_homology_query_date .
_Sequence_homology_query_revised_last_date .
save_
####################
# Natural source #
####################
save_natural_source
_Saveframe_category natural_source
loop_
_Mol_label
_Organism_name_common
_NCBI_taxonomy_ID
_Superkingdom
_Kingdom
_Genus
_Species
$HIVfsl HIV 12721 Viruses . Lentivirus HIV
stop_
save_
#########################
# Experimental source #
#########################
save_experimental_source
_Saveframe_category experimental_source
loop_
_Mol_label
_Production_method
_Host_organism_name_common
_Genus
_Species
_Strain
_Vector_name
_Details
$HIVfsl 'enzymatic semisynthesis' . . . . . 'The RNA was transcribed in vitro using T7 RNA polymerase.'
stop_
save_
#####################################
# Sample contents and methodology #
#####################################
########################
# Sample description #
########################
save_Sample_1
_Saveframe_category sample
_Sample_type solution
_Details .
loop_
_Mol_label
_Concentration_value
_Concentration_value_units
_Isotopic_labeling
$HIVfsl 1.0 mM .
stop_
save_
#########################
# Experimental detail #
#########################
##################################
# NMR Spectrometer definitions #
##################################
save_NMR_spectrometer_1
_Saveframe_category NMR_spectrometer
_Manufacturer Bruker
_Model DMX
_Field_strength 750
_Details .
save_
save_NMR_spectrometer_2
_Saveframe_category NMR_spectrometer
_Manufacturer Bruker
_Model DMX
_Field_strength 600
_Details .
save_
#############################
# NMR applied experiments #
#############################
save_1H-1H_NOESY_1
_Saveframe_category NMR_applied_experiment
_Experiment_name '1H-1H NOESY'
_Sample_label .
save_
save_1H-1H_TOCSY_2
_Saveframe_category NMR_applied_experiment
_Experiment_name '1H-1H TOCSY'
_Sample_label .
save_
save_1H-13C_HSQC_3
_Saveframe_category NMR_applied_experiment
_Experiment_name '1H-13C HSQC'
_Sample_label .
save_
save_HCCH-TOCSY_4
_Saveframe_category NMR_applied_experiment
_Experiment_name HCCH-TOCSY
_Sample_label .
save_
save_HCCH-COSY_5
_Saveframe_category NMR_applied_experiment
_Experiment_name HCCH-COSY
_Sample_label .
save_
save_HNN-COSY_6
_Saveframe_category NMR_applied_experiment
_Experiment_name HNN-COSY
_Sample_label .
save_
save_1H-13C-1H_NOESY_HMQC_7
_Saveframe_category NMR_applied_experiment
_Experiment_name '1H-13C-1H NOESY HMQC'
_Sample_label .
save_
save_NMR_spec_expt__0_1
_Saveframe_category NMR_applied_experiment
_Experiment_name '1H-1H NOESY'
_BMRB_pulse_sequence_accession_number .
_Details '600 MHz spectrometer was equipped with a cryoprobe.'
save_
save_NMR_spec_expt__0_2
_Saveframe_category NMR_applied_experiment
_Experiment_name '1H-1H TOCSY'
_BMRB_pulse_sequence_accession_number .
_Details '600 MHz spectrometer was equipped with a cryoprobe.'
save_
save_NMR_spec_expt__0_3
_Saveframe_category NMR_applied_experiment
_Experiment_name '1H-13C HSQC'
_BMRB_pulse_sequence_accession_number .
_Details '600 MHz spectrometer was equipped with a cryoprobe.'
save_
save_NMR_spec_expt__0_4
_Saveframe_category NMR_applied_experiment
_Experiment_name HCCH-TOCSY
_BMRB_pulse_sequence_accession_number .
_Details '600 MHz spectrometer was equipped with a cryoprobe.'
save_
save_NMR_spec_expt__0_5
_Saveframe_category NMR_applied_experiment
_Experiment_name HCCH-COSY
_BMRB_pulse_sequence_accession_number .
_Details '600 MHz spectrometer was equipped with a cryoprobe.'
save_
save_NMR_spec_expt__0_6
_Saveframe_category NMR_applied_experiment
_Experiment_name HNN-COSY
_BMRB_pulse_sequence_accession_number .
_Details '600 MHz spectrometer was equipped with a cryoprobe.'
save_
save_NMR_spec_expt__0_7
_Saveframe_category NMR_applied_experiment
_Experiment_name '1H-13C-1H NOESY HMQC'
_BMRB_pulse_sequence_accession_number .
_Details '600 MHz spectrometer was equipped with a cryoprobe.'
save_
#######################
# Sample conditions #
#######################
save_condition_1
_Saveframe_category sample_conditions
_Details .
loop_
_Variable_type
_Variable_value
_Variable_value_error
_Variable_value_units
pH 6.8 0.1 n/a
temperature 303 1 K
stop_
save_
save_condition_2
_Saveframe_category sample_conditions
_Details .
loop_
_Variable_type
_Variable_value
_Variable_value_error
_Variable_value_units
pH 6.8 0.1 n/a
temperature 283 1 K
stop_
save_
save_condition_3
_Saveframe_category sample_conditions
_Details .
loop_
_Variable_type
_Variable_value
_Variable_value_error
_Variable_value_units
pH 6.8 0.1 n/a
temperature 298 1 K
stop_
save_
####################
# NMR parameters #
####################
##############################
# Assigned chemical shifts #
##############################
################################
# Chemical shift referencing #
################################
save_chemical_shift_reference
_Saveframe_category chemical_shift_reference
_Details .
loop_
_Mol_common_name
_Atom_type
_Atom_isotope_number
_Atom_group
_Chem_shift_units
_Chem_shift_value
_Reference_method
_Reference_type
_External_reference_sample_geometry
_External_reference_location
_External_reference_axis
_Indirect_shift_ratio
DSS C 13 'methyl protons' ppm 0.0 . indirect . . . 0.251449530
DSS H 1 'methyl protons' ppm 0.0 internal direct . . . 1.0
DSS N 15 'methyl protons' ppm 0.0 . indirect . . . 0.101329118
stop_
save_
###################################
# Assigned chemical shift lists #
###################################
###################################################################
# Chemical Shift Ambiguity Index Value Definitions #
# #
# The values other than 1 are used for those atoms with different #
# chemical shifts that cannot be assigned to stereospecific atoms #
# or to specific residues or chains. #
# #
# Index Value Definition #
# #
# 1 Unique (including isolated methyl protons, #
# geminal atoms, and geminal methyl #
# groups with identical chemical shifts) #
# (e.g. ILE HD11, HD12, HD13 protons) #
# 2 Ambiguity of geminal atoms or geminal methyl #
# proton groups (e.g. ASP HB2 and HB3 #
# protons, LEU CD1 and CD2 carbons, or #
# LEU HD11, HD12, HD13 and HD21, HD22, #
# HD23 methyl protons) #
# 3 Aromatic atoms on opposite sides of #
# symmetrical rings (e.g. TYR HE1 and HE2 #
# protons) #
# 4 Intraresidue ambiguities (e.g. LYS HG and #
# HD protons or TRP HZ2 and HZ3 protons) #
# 5 Interresidue ambiguities (LYS 12 vs. LYS 27) #
# 6 Intermolecular ambiguities (e.g. ASP 31 CA #
# in monomer 1 and ASP 31 CA in monomer 2 #
# of an asymmetrical homodimer, duplex #
# DNA assignments, or other assignments #
# that may apply to atoms in one or more #
# molecule in the molecular assembly) #
# 9 Ambiguous, specific ambiguity not defined #
# #
###################################################################
save_chemical_shift_list
_Saveframe_category assigned_chemical_shifts
_Details .
loop_
_Sample_label
$Sample_1
stop_
_Sample_conditions_label $condition_1
_Chem_shift_reference_set_label $chemical_shift_reference
_Mol_system_component_name 'HIV-1 frameshift inducing stem-loop RNA'
_Text_data_format .
_Text_data .
loop_
_Atom_shift_assign_ID
_Residue_author_seq_code
_Residue_seq_code
_Residue_label
_Atom_name
_Atom_type
_Chem_shift_value
_Chem_shift_value_error
_Chem_shift_ambiguity_code
1 . 1 G C1' C 90.224 . 1
2 . 1 G C8 C 139.005 . 1
3 . 1 G H1 H 12.955 . 1
4 . 1 G H1' H 5.755 . 1
5 . 1 G H2' H 4.882 . 1
6 . 1 G H3' H 4.76 . 1
7 . 1 G H4' H 4.501 . 1
8 . 1 G H8 H 8.13 . 1
9 . 1 G N1 N 147.359 . 1
10 . 1 G N3 N 162.186 . 1
11 . 1 G N7 N 217.632 . 1
12 . 2 G C1' C 92.722 . 1
13 . 2 G C8 C 136.992 . 1
14 . 2 G H1 H 13.407 . 1
15 . 2 G H1' H 5.874 . 1
16 . 2 G H2' H 4.529 . 1
17 . 2 G H21 H 8.373 . 1
18 . 2 G H22 H 7.585 . 1
19 . 2 G H3' H 4.507 . 1
20 . 2 G H4' H 4.565 . 1
21 . 2 G H8 H 7.67 . 1
22 . 2 G N1 N 148.384 . 1
23 . 2 G N3 N 161.55 . 1
24 . 2 G N7 N 218.419 . 1
25 . 3 C C1' C 93.773 . 1
26 . 3 C C5 C 97.005 . 1
27 . 3 C C6 C 140.864 . 1
28 . 3 C H1' H 5.528 . 1
29 . 3 C H2' H 4.412 . 1
30 . 3 C H3' H 4.34 . 1
31 . 3 C H41 H 8.603 . 1
32 . 3 C H42 H 6.847 . 1
33 . 3 C H5 H 5.25 . 1
34 . 3 C H6 H 7.672 . 1
35 . 3 C N3 N 197.487 . 1
36 . 4 C C1' C 94.105 . 1
37 . 4 C C5 C 97.88 . 1
38 . 4 C C6 C 141.513 . 1
39 . 4 C H1' H 5.483 . 1
40 . 4 C H2' H 4.392 . 1
41 . 4 C H3' H 4.384 . 1
42 . 4 C H4' H 4.399 . 1
43 . 4 C H41 H 8.482 . 1
44 . 4 C H42 H 6.877 . 1
45 . 4 C H5 H 5.536 . 1
46 . 4 C H6 H 7.717 . 1
47 . 4 C N3 N 196.969 . 1
48 . 5 U C1' C 93.986 . 1
49 . 5 U C5 C 103.154 . 1
50 . 5 U C6 C 139.823 . 1
51 . 5 U H1' H 5.491 . 1
52 . 5 U H2' H 4.424 . 1
53 . 5 U H3 H 13.843 . 1
54 . 5 U H3' H 4.486 . 1
55 . 5 U H4' H 4.412 . 1
56 . 5 U H5 H 5.399 . 1
57 . 5 U H6 H 7.88 . 1
58 . 5 U N3 N 161.656 . 1
59 . 6 U C1' C 93.565 . 1
60 . 6 U C5 C 102.868 . 1
61 . 6 U C6 C 140.304 . 1
62 . 6 U H1' H 5.595 . 1
63 . 6 U H2' H 4.376 . 1
64 . 6 U H3 H 13.691 . 1
65 . 6 U H3' H 4.505 . 1
66 . 6 U H4' H 4.419 . 1
67 . 6 U H5 H 5.557 . 1
68 . 6 U H6 H 8.022 . 1
69 . 6 U N3 N 162.344 . 1
70 . 7 C C1' C 93.796 . 1
71 . 7 C C5 C 97.037 . 1
72 . 7 C C6 C 141.704 . 1
73 . 7 C H1' H 5.455 . 1
74 . 7 C H2' H 4.193 . 1
75 . 7 C H3' H 4.409 . 1
76 . 7 C H4' H 4.38 . 1
77 . 7 C H41 H 8.23 . 1
78 . 7 C H42 H 6.732 . 1
79 . 7 C H5 H 5.572 . 1
80 . 7 C H6 H 7.843 . 1
81 . 7 C N3 N 197.983 . 1
82 . 8 C C2' C 93.761 . 1
83 . 8 C C5 C 97.14 . 1
84 . 8 C C6 C 141.083 . 1
85 . 8 C H1' H 5.347 . 1
86 . 8 C H2' H 4.258 . 1
87 . 8 C H3' H 4.404 . 1
88 . 8 C H4' H 4.311 . 1
89 . 8 C H41 H 8.239 . 1
90 . 8 C H42 H 6.708 . 1
91 . 8 C H5 H 5.331 . 1
92 . 8 C H6 H 7.702 . 1
93 . 8 C N3 N 196.661 . 1
94 . 9 C C1' C 93.695 . 1
95 . 9 C C5 C 97.061 . 1
96 . 9 C C6 C 140.729 . 1
97 . 9 C H1' H 5.407 . 1
98 . 9 C H2' H 4.558 . 1
99 . 9 C H3' H 4.334 . 1
100 . 9 C H4' H 4.319 . 1
101 . 9 C H41 H 7.698 . 1
102 . 9 C H42 H 5.688 . 1
103 . 9 C H5 H 5.148 . 1
104 . 9 C H6 H 7.493 . 1
105 . 9 C N3 N 195.496 . 1
106 . 10 A C1' C 93.184 . 1
107 . 10 A C2 C 152.073 . 1
108 . 10 A C8 C 137.454 . 1
109 . 10 A H1' H 5.698 . 1
110 . 10 A H2 H 7.564 . 1
111 . 10 A H2' H 4.4 . 1
112 . 10 A H3' H 4.458 . 1
113 . 10 A H4' H 4.392 . 1
114 . 10 A H8 H 8.029 . 1
115 . 11 C C1' C 89.872 . 1
116 . 11 C C5 C 98.08 . 1
117 . 11 C C6 C 142.691 . 1
118 . 11 C H1' H 5.576 . 1
119 . 11 C H2' H 3.997 . 1
120 . 11 C H3' H 4.275 . 1
121 . 11 C H4' H 3.66 . 1
122 . 11 C H5 H 5.425 . 1
123 . 11 C H5'' H 3.777 . 1
124 . 11 C H6 H 7.444 . 1
125 . 12 A C1' C 89.971 . 1
126 . 12 A C2 C 152.663 . 1
127 . 12 A C8 C 139.299 . 1
128 . 12 A H1' H 5.77 . 1
129 . 12 A H2 H 7.968 . 1
130 . 12 A H2' H 4.523 . 1
131 . 12 A H3' H 4.648 . 1
132 . 12 A H4' H 4.32 . 1
133 . 12 A H8 H 8.079 . 1
134 . 13 A C1' C 90.538 . 1
135 . 13 A C2 C 152.788 . 1
136 . 13 A C8 C 139.66 . 1
137 . 13 A H1' H 6.058 . 1
138 . 13 A H2 H 8.062 . 1
139 . 13 A H2' H 4.775 . 1
140 . 13 A H3' H 4.902 . 1
141 . 13 A H4' H 4.552 . 1
142 . 13 A H8 H 8.331 . 1
143 . 14 G C1' C 92.42 . 1
144 . 14 G C8 C 137.303 . 1
145 . 14 G H1 H 12.022 . 1
146 . 14 G H1' H 5.014 . 1
147 . 14 G H2' H 4.539 . 1
148 . 14 G H21 H 8.216 . 1
149 . 14 G H22 H 6.038 . 1
150 . 14 G H3' H 4.26 . 1
151 . 14 G H4' H 4.441 . 1
152 . 14 G H8 H 7.685 . 1
153 . 14 G N1 N 146.803 . 1
154 . 14 G N3 N 162.976 . 1
155 . 14 G N7 N 217.005 . 1
156 . 15 G C1' C 92.713 . 1
157 . 15 G C8 C 135.971 . 1
158 . 15 G H1 H 12.333 . 1
159 . 15 G H1' H 5.754 . 1
160 . 15 G H2' H 4.421 . 1
161 . 15 G H21 H 8.217 . 1
162 . 15 G H22 H 5.784 . 1
163 . 15 G H3' H 4.577 . 1
164 . 15 G H8 H 7.199 . 1
165 . 15 G N1 N 147.26 . 1
166 . 15 G N3 N 162.551 . 1
167 . 15 G N7 N 217.259 . 1
168 . 16 G C1' C 92.833 . 1
169 . 16 G C8 C 136.05 . 1
170 . 16 G H1 H 12.1 . 1
171 . 16 G H1' H 5.695 . 1
172 . 16 G H2' H 4.54 . 1
173 . 16 G H21 H 7.824 . 1
174 . 16 G H22 H 5.684 . 1
175 . 16 G H8 H 7.091 . 1
176 . 16 G N1 N 147.004 . 1
177 . 16 G N3 N 162.784 . 1
178 . 16 G N7 N 217.082 . 1
179 . 17 A C1' C 92.99 . 1
180 . 17 A C2 C 150.46 . 1
181 . 17 A C8 C 136.632 . 1
182 . 17 A H1' H 5.847 . 1
183 . 17 A H2 H 7.047 . 1
184 . 17 A H2' H 4.542 . 1
185 . 17 A H3' H 4.57 . 1
186 . 17 A H4' H 4.445 . 1
187 . 17 A H61 H 7.749 . 1
188 . 17 A H62 H 6.527 . 1
189 . 17 A H8 H 7.595 . 1
190 . 17 A N1 N 220.173 . 1
191 . 18 A C1' C 92.411 . 1
192 . 18 A C2 C 150.732 . 1
193 . 18 A C8 C 136.623 . 1
194 . 18 A H1' H 5.837 . 1
195 . 18 A H2 H 7.414 . 1
196 . 18 A H2' H 4.554 . 1
197 . 18 A H3' H 4.356 . 1
198 . 18 A H4' H 4.428 . 1
199 . 18 A H61 H 7.881 . 1
200 . 18 A H62 H 6.492 . 1
201 . 18 A H8 H 7.615 . 1
202 . 18 A N1 N 219.986 . 1
203 . 19 G C1' C 92.42 . 1
204 . 19 G C8 C 135.597 . 1
205 . 19 G H1 H 12.857 . 1
206 . 19 G H1' H 5.524 . 1
207 . 19 G H2' H 4.463 . 1
208 . 19 G H21 H 8.225 . 1
209 . 19 G H22 H 6.002 . 1
210 . 19 G H3' H 4.515 . 1
211 . 19 G H8 H 7.002 . 1
212 . 19 G N1 N 147.464 . 1
213 . 19 G N3 N 162.374 . 1
214 . 19 G N7 N 217.519 . 1
215 . 20 G C1' C 92.833 . 1
216 . 20 G C8 C 136.21 . 1
217 . 20 G H1 H 13.278 . 1
218 . 20 G H1' H 5.701 . 1
219 . 20 G H2' H 4.46 . 1
220 . 20 G H21 H 8.453 . 1
221 . 20 G H22 H 7.668 . 1
222 . 20 G H8 H 7.208 . 1
223 . 20 G N1 N 148.747 . 1
224 . 20 G N7 N 218.748 . 1
225 . 21 C C1' C 93.996 . 1
226 . 21 C C5 C 96.898 . 1
227 . 21 C C6 C 140.921 . 1
228 . 21 C H1' H 5.502 . 1
229 . 21 C H2' H 4.25 . 1
230 . 21 C H3' H 4.49 . 1
231 . 21 C H4' H 4.357 . 1
232 . 21 C H41 H 8.543 . 1
233 . 21 C H42 H 6.877 . 1
234 . 21 C H5 H 5.162 . 1
235 . 21 C H6 H 7.583 . 1
236 . 21 C N3 N 197.988 . 1
237 . 22 C C1' C 92.713 . 1
238 . 22 C C5 C 98.072 . 1
239 . 22 C C6 C 141.674 . 1
240 . 22 C H1' H 5.739 . 1
241 . 22 C H2' H 3.964 . 1
242 . 22 C H4' H 4.127 . 1
243 . 22 C H5 H 5.5 . 1
244 . 22 C H6 H 7.644 . 1
245 . 22 C N3 N 196.9 . 1
stop_
save_