data_17655 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 17655 _Entry.Title ; Structure of Human Telomeric DNA in Crowded Solution ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2011-05-17 _Entry.Accession_date 2011-05-17 _Entry.Last_release_date 2011-08-02 _Entry.Original_release_date 2011-08-02 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Brahim Heddi . . . 17655 2 'Anh Tuan' Phan . . . 17655 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 17655 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID G-quadruplex . 17655 'Molecular crowding' . 17655 'propeller-type parallel-stranded' . 17655 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 17655 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 175 17655 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2011-08-02 2011-05-17 original author . 17655 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 1KF1 . 17655 PDB 2gku . 17655 PDB 2JSL . 17655 PDB 2kf8 . 17655 PDB 2km3 . 17655 PDB 2LD8 'BMRB Entry Tracking System' 17655 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 17655 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID . _Citation.Full_citation . _Citation.Title 'Structure of Human Telomeric DNA in Crowded Solution' _Citation.Status 'in press' _Citation.Type journal _Citation.Journal_abbrev 'J. Am. Chem. Soc.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Brahim Heddi . . . 17655 1 2 'Anh Tuan' Phan . . . 17655 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 17655 _Assembly.ID 1 _Assembly.Name 'Human Telomeric DNA' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'Human Telomeric DNA' 1 $Human_Telomeric_DNA A . yes native no no . . . 17655 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_Human_Telomeric_DNA _Entity.Sf_category entity _Entity.Sf_framecode Human_Telomeric_DNA _Entity.Entry_ID 17655 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name DNA_(5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3')_ _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; TAGGGTTAGGGTTAGGGTTA GGG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 23 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 7287.750 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DT . 17655 1 2 . DA . 17655 1 3 . DG . 17655 1 4 . DG . 17655 1 5 . DG . 17655 1 6 . DT . 17655 1 7 . DT . 17655 1 8 . DA . 17655 1 9 . DG . 17655 1 10 . DG . 17655 1 11 . DG . 17655 1 12 . DT . 17655 1 13 . DT . 17655 1 14 . DA . 17655 1 15 . DG . 17655 1 16 . DG . 17655 1 17 . DG . 17655 1 18 . DT . 17655 1 19 . DT . 17655 1 20 . DA . 17655 1 21 . DG . 17655 1 22 . DG . 17655 1 23 . DG . 17655 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DT 1 1 17655 1 . DA 2 2 17655 1 . DG 3 3 17655 1 . DG 4 4 17655 1 . DG 5 5 17655 1 . DT 6 6 17655 1 . DT 7 7 17655 1 . DA 8 8 17655 1 . DG 9 9 17655 1 . DG 10 10 17655 1 . DG 11 11 17655 1 . DT 12 12 17655 1 . DT 13 13 17655 1 . DA 14 14 17655 1 . DG 15 15 17655 1 . DG 16 16 17655 1 . DG 17 17 17655 1 . DT 18 18 17655 1 . DT 19 19 17655 1 . DA 20 20 17655 1 . DG 21 21 17655 1 . DG 22 22 17655 1 . DG 23 23 17655 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 17655 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $Human_Telomeric_DNA . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . . . . . . . . . 17655 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 17655 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $Human_Telomeric_DNA . 'chemical synthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17655 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 17655 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system 'PEG 200/water' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 Human_Telomeric_DNA 'natural abundance' . . 1 $Human_Telomeric_DNA . . . 0.2 1 mM . . . . 17655 1 2 'PEG 200' 'natural abundance' . . . . . . . . . mM . . . . 17655 1 3 H2O 'natural abundance' . . . . . . . . . mM . . . . 17655 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 17655 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH 7.00 . pH 17655 1 pressure 1 . atm 17655 1 temperature 310 . K 17655 1 stop_ save_ ############################ # Computer software used # ############################ save_X-PLOR_NIH _Software.Sf_category software _Software.Sf_framecode X-PLOR_NIH _Software.Entry_ID 17655 _Software.ID 1 _Software.Name 'X-PLOR NIH' _Software.Version 2.26 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 17655 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 17655 1 stop_ save_ save_AMBER _Software.Sf_category software _Software.Sf_framecode AMBER _Software.Entry_ID 17655 _Software.ID 2 _Software.Name AMBER _Software.Version 10.0 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm' . . 17655 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 17655 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 17655 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AMX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_2 _NMR_spectrometer.Entry_ID 17655 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AMX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 17655 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker AMX . 600 . . . 17655 1 2 spectrometer_2 Bruker AMX . 700 . . . 17655 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 17655 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17655 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 17655 1 3 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17655 1 4 '2D 1H-1H COSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17655 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 17655 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.0 . . . . . . . . . 17655 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 17655 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 17655 1 3 '2D 1H-1H TOCSY' . . . 17655 1 4 '2D 1H-1H COSY' . . . 17655 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 DT H1' H 1 5.999 . . . . . . A 1 DT H1' . 17655 1 2 . 1 1 1 1 DT H2' H 1 2.247 . . . . . . A 1 DT H2' . 17655 1 3 . 1 1 1 1 DT H2'' H 1 1.835 . . 2 . . . A 1 DT H2'' . 17655 1 4 . 1 1 1 1 DT H3' H 1 4.611 . . . . . . A 1 DT H3' . 17655 1 5 . 1 1 1 1 DT H4' H 1 3.960 . . . . . . A 1 DT H4' . 17655 1 6 . 1 1 1 1 DT H6 H 1 7.407 . . 1 . . . A 1 DT H6 . 17655 1 7 . 1 1 1 1 DT H71 H 1 1.741 . . 1 . . . . 1 DT H7 . 17655 1 8 . 1 1 1 1 DT H72 H 1 1.741 . . 1 . . . . 1 DT H7 . 17655 1 9 . 1 1 1 1 DT H73 H 1 1.741 . . 1 . . . . 1 DT H7 . 17655 1 10 . 1 1 2 2 DA H1' H 1 6.213 . . . . . . A 2 DA H1' . 17655 1 11 . 1 1 2 2 DA H2 H 1 8.000 . . 1 . . . A 2 DA H2 . 17655 1 12 . 1 1 2 2 DA H2' H 1 2.757 . . . . . . A 2 DA H2' . 17655 1 13 . 1 1 2 2 DA H2'' H 1 2.747 . . 2 . . . A 2 DA H2'' . 17655 1 14 . 1 1 2 2 DA H3' H 1 4.972 . . . . . . A 2 DA H3' . 17655 1 15 . 1 1 2 2 DA H4' H 1 4.301 . . . . . . A 2 DA H4' . 17655 1 16 . 1 1 2 2 DA H5' H 1 3.985 . . . . . . A 2 DA H5' . 17655 1 17 . 1 1 2 2 DA H5'' H 1 3.923 . . 2 . . . A 2 DA H5'' . 17655 1 18 . 1 1 2 2 DA H8 H 1 8.253 . . 1 . . . A 2 DA H8 . 17655 1 19 . 1 1 3 3 DG H1' H 1 6.066 . . . . . . A 3 DG H1' . 17655 1 20 . 1 1 3 3 DG H2' H 1 2.936 . . . . . . A 3 DG H2' . 17655 1 21 . 1 1 3 3 DG H2'' H 1 2.740 . . . . . . A 3 DG H2'' . 17655 1 22 . 1 1 3 3 DG H3' H 1 4.963 . . . . . . A 3 DG H3' . 17655 1 23 . 1 1 3 3 DG H4' H 1 4.418 . . . . . . A 3 DG H4' . 17655 1 24 . 1 1 3 3 DG H5' H 1 4.150 . . . . . . A 3 DG H5' . 17655 1 25 . 1 1 3 3 DG H8 H 1 8.065 . . 1 . . . A 3 DG H8 . 17655 1 26 . 1 1 4 4 DG H1' H 1 6.106 . . . . . . A 4 DG H1' . 17655 1 27 . 1 1 4 4 DG H2' H 1 2.747 . . . . . . A 4 DG H2' . 17655 1 28 . 1 1 4 4 DG H2'' H 1 2.606 . . . . . . A 4 DG H2'' . 17655 1 29 . 1 1 4 4 DG H3' H 1 4.919 . . . . . . A 4 DG H3' . 17655 1 30 . 1 1 4 4 DG H4' H 1 4.376 . . . . . . A 4 DG H4' . 17655 1 31 . 1 1 4 4 DG H8 H 1 7.749 . . 1 . . . A 4 DG H8 . 17655 1 32 . 1 1 5 5 DG H1' H 1 6.258 . . . . . . A 5 DG H1' . 17655 1 33 . 1 1 5 5 DG H2' H 1 2.759 . . . . . . A 5 DG H2' . 17655 1 34 . 1 1 5 5 DG H2'' H 1 2.448 . . . . . . A 5 DG H2'' . 17655 1 35 . 1 1 5 5 DG H3' H 1 4.924 . . . . . . A 5 DG H3' . 17655 1 36 . 1 1 5 5 DG H4' H 1 4.348 . . . . . . A 5 DG H4' . 17655 1 37 . 1 1 5 5 DG H5'' H 1 4.010 . . 2 . . . A 5 DG H5'' . 17655 1 38 . 1 1 5 5 DG H8 H 1 7.847 . . 1 . . . A 5 DG H8 . 17655 1 39 . 1 1 6 6 DT H1' H 1 6.312 . . . . . . A 6 DT H1' . 17655 1 40 . 1 1 6 6 DT H2' H 1 2.458 . . . . . . A 6 DT H2' . 17655 1 41 . 1 1 6 6 DT H2'' H 1 2.478 . . 2 . . . A 6 DT H2'' . 17655 1 42 . 1 1 6 6 DT H3' H 1 4.862 . . . . . . A 6 DT H3' . 17655 1 43 . 1 1 6 6 DT H4' H 1 4.310 . . . . . . A 6 DT H4' . 17655 1 44 . 1 1 6 6 DT H5' H 1 4.137 . . . . . . A 6 DT H5' . 17655 1 45 . 1 1 6 6 DT H5'' H 1 4.027 . . 2 . . . A 6 DT H5'' . 17655 1 46 . 1 1 6 6 DT H6 H 1 7.721 . . 1 . . . A 6 DT H6 . 17655 1 47 . 1 1 6 6 DT H71 H 1 1.919 . . 1 . . . . 6 DT H7 . 17655 1 48 . 1 1 6 6 DT H72 H 1 1.919 . . 1 . . . . 6 DT H7 . 17655 1 49 . 1 1 6 6 DT H73 H 1 1.919 . . 1 . . . . 6 DT H7 . 17655 1 50 . 1 1 7 7 DT H1' H 1 6.266 . . . . . . A 7 DT H1' . 17655 1 51 . 1 1 7 7 DT H2' H 1 2.450 . . . . . . A 7 DT H2' . 17655 1 52 . 1 1 7 7 DT H2'' H 1 2.249 . . 2 . . . A 7 DT H2'' . 17655 1 53 . 1 1 7 7 DT H3' H 1 4.865 . . . . . . A 7 DT H3' . 17655 1 54 . 1 1 7 7 DT H4' H 1 4.259 . . . . . . A 7 DT H4' . 17655 1 55 . 1 1 7 7 DT H5'' H 1 4.058 . . 2 . . . A 7 DT H5'' . 17655 1 56 . 1 1 7 7 DT H6 H 1 7.742 . . 1 . . . A 7 DT H6 . 17655 1 57 . 1 1 7 7 DT H71 H 1 1.970 . . 1 . . . . 7 DT H7 . 17655 1 58 . 1 1 7 7 DT H72 H 1 1.970 . . 1 . . . . 7 DT H7 . 17655 1 59 . 1 1 7 7 DT H73 H 1 1.970 . . 1 . . . . 7 DT H7 . 17655 1 60 . 1 1 8 8 DA H1' H 1 6.519 . . . . . . A 8 DA H1' . 17655 1 61 . 1 1 8 8 DA H2 H 1 8.251 . . 1 . . . A 8 DA H2 . 17655 1 62 . 1 1 8 8 DA H2' H 1 2.936 . . . . . . A 8 DA H2' . 17655 1 63 . 1 1 8 8 DA H2'' H 1 2.821 . . 2 . . . A 8 DA H2'' . 17655 1 64 . 1 1 8 8 DA H3' H 1 5.082 . . . . . . A 8 DA H3' . 17655 1 65 . 1 1 8 8 DA H4' H 1 4.463 . . . . . . A 8 DA H4' . 17655 1 66 . 1 1 8 8 DA H5' H 1 4.177 . . . . . . A 8 DA H5' . 17655 1 67 . 1 1 8 8 DA H5'' H 1 4.111 . . 2 . . . A 8 DA H5'' . 17655 1 68 . 1 1 8 8 DA H8 H 1 8.514 . . 1 . . . A 8 DA H8 . 17655 1 69 . 1 1 9 9 DG H1' H 1 6.139 . . . . . . A 9 DG H1' . 17655 1 70 . 1 1 9 9 DG H2' H 1 2.955 . . . . . . A 9 DG H2' . 17655 1 71 . 1 1 9 9 DG H2'' H 1 2.640 . . . . . . A 9 DG H2'' . 17655 1 72 . 1 1 9 9 DG H3' H 1 5.002 . . . . . . A 9 DG H3' . 17655 1 73 . 1 1 9 9 DG H4' H 1 4.407 . . . . . . A 9 DG H4' . 17655 1 74 . 1 1 9 9 DG H5' H 1 4.114 . . . . . . A 9 DG H5' . 17655 1 75 . 1 1 9 9 DG H5'' H 1 4.069 . . 2 . . . A 9 DG H5'' . 17655 1 76 . 1 1 9 9 DG H8 H 1 8.125 . . 1 . . . A 9 DG H8 . 17655 1 77 . 1 1 10 10 DG H1' H 1 6.108 . . . . . . A 10 DG H1' . 17655 1 78 . 1 1 10 10 DG H2' H 1 2.811 . . . . . . A 10 DG H2' . 17655 1 79 . 1 1 10 10 DG H2'' H 1 2.635 . . 2 . . . A 10 DG H2'' . 17655 1 80 . 1 1 10 10 DG H3' H 1 4.957 . . . . . . A 10 DG H3' . 17655 1 81 . 1 1 10 10 DG H4' H 1 4.397 . . . . . . A 10 DG H4' . 17655 1 82 . 1 1 10 10 DG H8 H 1 7.811 . . 1 . . . A 10 DG H8 . 17655 1 83 . 1 1 11 11 DG H1' H 1 6.258 . . . . . . A 11 DG H1' . 17655 1 84 . 1 1 11 11 DG H2' H 1 2.803 . . . . . . A 11 DG H2' . 17655 1 85 . 1 1 11 11 DG H2'' H 1 2.571 . . 2 . . . A 11 DG H2'' . 17655 1 86 . 1 1 11 11 DG H3' H 1 4.949 . . . . . . A 11 DG H3' . 17655 1 87 . 1 1 11 11 DG H4' H 1 4.348 . . . . . . A 11 DG H4' . 17655 1 88 . 1 1 11 11 DG H5' H 1 4.159 . . . . . . A 11 DG H5' . 17655 1 89 . 1 1 11 11 DG H5'' H 1 4.035 . . 2 . . . A 11 DG H5'' . 17655 1 90 . 1 1 11 11 DG H8 H 1 7.874 . . 1 . . . A 11 DG H8 . 17655 1 91 . 1 1 12 12 DT H1' H 1 6.314 . . . . . . A 12 DT H1' . 17655 1 92 . 1 1 12 12 DT H2' H 1 2.458 . . . . . . A 12 DT H2' . 17655 1 93 . 1 1 12 12 DT H2'' H 1 2.478 . . 2 . . . A 12 DT H2'' . 17655 1 94 . 1 1 12 12 DT H3' H 1 4.857 . . . . . . A 12 DT H3' . 17655 1 95 . 1 1 12 12 DT H4' H 1 4.310 . . . . . . A 12 DT H4' . 17655 1 96 . 1 1 12 12 DT H5' H 1 4.136 . . . . . . A 12 DT H5' . 17655 1 97 . 1 1 12 12 DT H5'' H 1 4.027 . . 2 . . . A 12 DT H5'' . 17655 1 98 . 1 1 12 12 DT H6 H 1 7.720 . . 1 . . . A 12 DT H6 . 17655 1 99 . 1 1 12 12 DT H71 H 1 1.919 . . 1 . . . . 12 DT H7 . 17655 1 100 . 1 1 12 12 DT H72 H 1 1.919 . . 1 . . . . 12 DT H7 . 17655 1 101 . 1 1 12 12 DT H73 H 1 1.919 . . 1 . . . . 12 DT H7 . 17655 1 102 . 1 1 13 13 DT H1' H 1 6.280 . . . . . . A 13 DT H1' . 17655 1 103 . 1 1 13 13 DT H2' H 1 2.463 . . . . . . A 13 DT H2' . 17655 1 104 . 1 1 13 13 DT H2'' H 1 2.269 . . 2 . . . A 13 DT H2'' . 17655 1 105 . 1 1 13 13 DT H3' H 1 4.874 . . . . . . A 13 DT H3' . 17655 1 106 . 1 1 13 13 DT H4' H 1 4.319 . . . . . . A 13 DT H4' . 17655 1 107 . 1 1 13 13 DT H5' H 1 4.271 . . . . . . A 13 DT H5' . 17655 1 108 . 1 1 13 13 DT H5'' H 1 4.068 . . 2 . . . A 13 DT H5'' . 17655 1 109 . 1 1 13 13 DT H6 H 1 7.763 . . 1 . . . A 13 DT H6 . 17655 1 110 . 1 1 13 13 DT H71 H 1 1.971 . . 1 . . . . 13 DT H7 . 17655 1 111 . 1 1 13 13 DT H72 H 1 1.971 . . 1 . . . . 13 DT H7 . 17655 1 112 . 1 1 13 13 DT H73 H 1 1.971 . . 1 . . . . 13 DT H7 . 17655 1 113 . 1 1 14 14 DA H1' H 1 6.496 . . . . . . A 14 DA H1' . 17655 1 114 . 1 1 14 14 DA H2 H 1 8.220 . . 1 . . . A 14 DA H2 . 17655 1 115 . 1 1 14 14 DA H2' H 1 2.894 . . . . . . A 14 DA H2' . 17655 1 116 . 1 1 14 14 DA H2'' H 1 2.808 . . 2 . . . A 14 DA H2'' . 17655 1 117 . 1 1 14 14 DA H3' H 1 5.070 . . . . . . A 14 DA H3' . 17655 1 118 . 1 1 14 14 DA H4' H 1 4.458 . . . . . . A 14 DA H4' . 17655 1 119 . 1 1 14 14 DA H5' H 1 4.169 . . . . . . A 14 DA H5' . 17655 1 120 . 1 1 14 14 DA H5'' H 1 4.098 . . 2 . . . A 14 DA H5'' . 17655 1 121 . 1 1 14 14 DA H8 H 1 8.489 . . 1 . . . A 14 DA H8 . 17655 1 122 . 1 1 15 15 DG H1' H 1 6.137 . . . . . . A 15 DG H1' . 17655 1 123 . 1 1 15 15 DG H2' H 1 2.954 . . . . . . A 15 DG H2' . 17655 1 124 . 1 1 15 15 DG H2'' H 1 2.641 . . . . . . A 15 DG H2'' . 17655 1 125 . 1 1 15 15 DG H3' H 1 5.000 . . . . . . A 15 DG H3' . 17655 1 126 . 1 1 15 15 DG H4' H 1 4.401 . . . . . . A 15 DG H4' . 17655 1 127 . 1 1 15 15 DG H5' H 1 4.087 . . . . . . A 15 DG H5' . 17655 1 128 . 1 1 15 15 DG H8 H 1 8.105 . . 1 . . . A 15 DG H8 . 17655 1 129 . 1 1 16 16 DG H1' H 1 6.110 . . . . . . A 16 DG H1' . 17655 1 130 . 1 1 16 16 DG H2' H 1 2.807 . . . . . . A 16 DG H2' . 17655 1 131 . 1 1 16 16 DG H2'' H 1 2.635 . . 2 . . . A 16 DG H2'' . 17655 1 132 . 1 1 16 16 DG H3' H 1 4.959 . . . . . . A 16 DG H3' . 17655 1 133 . 1 1 16 16 DG H4' H 1 4.393 . . . . . . A 16 DG H4' . 17655 1 134 . 1 1 16 16 DG H8 H 1 7.809 . . 1 . . . A 16 DG H8 . 17655 1 135 . 1 1 17 17 DG H1' H 1 6.258 . . . . . . A 17 DG H1' . 17655 1 136 . 1 1 17 17 DG H2' H 1 2.803 . . . . . . A 17 DG H2' . 17655 1 137 . 1 1 17 17 DG H2'' H 1 2.578 . . 2 . . . A 17 DG H2'' . 17655 1 138 . 1 1 17 17 DG H3' H 1 4.950 . . . . . . A 17 DG H3' . 17655 1 139 . 1 1 17 17 DG H4' H 1 4.348 . . . . . . A 17 DG H4' . 17655 1 140 . 1 1 17 17 DG H5' H 1 4.159 . . . . . . A 17 DG H5' . 17655 1 141 . 1 1 17 17 DG H5'' H 1 4.035 . . 2 . . . A 17 DG H5'' . 17655 1 142 . 1 1 17 17 DG H8 H 1 7.873 . . 1 . . . A 17 DG H8 . 17655 1 143 . 1 1 18 18 DT H1' H 1 6.314 . . . . . . A 18 DT H1' . 17655 1 144 . 1 1 18 18 DT H2' H 1 2.458 . . . . . . A 18 DT H2' . 17655 1 145 . 1 1 18 18 DT H2'' H 1 2.478 . . 2 . . . A 18 DT H2'' . 17655 1 146 . 1 1 18 18 DT H3' H 1 4.863 . . . . . . A 18 DT H3' . 17655 1 147 . 1 1 18 18 DT H4' H 1 4.310 . . . . . . A 18 DT H4' . 17655 1 148 . 1 1 18 18 DT H5' H 1 4.136 . . . . . . A 18 DT H5' . 17655 1 149 . 1 1 18 18 DT H5'' H 1 4.026 . . 2 . . . A 18 DT H5'' . 17655 1 150 . 1 1 18 18 DT H6 H 1 7.719 . . 1 . . . A 18 DT H6 . 17655 1 151 . 1 1 18 18 DT H71 H 1 1.919 . . 1 . . . . 18 DT H7 . 17655 1 152 . 1 1 18 18 DT H72 H 1 1.919 . . 1 . . . . 18 DT H7 . 17655 1 153 . 1 1 18 18 DT H73 H 1 1.919 . . 1 . . . . 18 DT H7 . 17655 1 154 . 1 1 19 19 DT H1' H 1 6.265 . . . . . . A 19 DT H1' . 17655 1 155 . 1 1 19 19 DT H2' H 1 2.450 . . . . . . A 19 DT H2' . 17655 1 156 . 1 1 19 19 DT H2'' H 1 2.249 . . 2 . . . A 19 DT H2'' . 17655 1 157 . 1 1 19 19 DT H3' H 1 4.865 . . . . . . A 19 DT H3' . 17655 1 158 . 1 1 19 19 DT H4' H 1 4.259 . . . . . . A 19 DT H4' . 17655 1 159 . 1 1 19 19 DT H5'' H 1 4.059 . . 2 . . . A 19 DT H5'' . 17655 1 160 . 1 1 19 19 DT H6 H 1 7.746 . . 1 . . . A 19 DT H6 . 17655 1 161 . 1 1 19 19 DT H71 H 1 1.968 . . 1 . . . . 19 DT H7 . 17655 1 162 . 1 1 19 19 DT H72 H 1 1.968 . . 1 . . . . 19 DT H7 . 17655 1 163 . 1 1 19 19 DT H73 H 1 1.968 . . 1 . . . . 19 DT H7 . 17655 1 164 . 1 1 20 20 DA H1' H 1 6.522 . . . . . . A 20 DA H1' . 17655 1 165 . 1 1 20 20 DA H2 H 1 8.252 . . 1 . . . A 20 DA H2 . 17655 1 166 . 1 1 20 20 DA H2' H 1 2.936 . . . . . . A 20 DA H2' . 17655 1 167 . 1 1 20 20 DA H2'' H 1 2.822 . . 2 . . . A 20 DA H2'' . 17655 1 168 . 1 1 20 20 DA H3' H 1 5.081 . . . . . . A 20 DA H3' . 17655 1 169 . 1 1 20 20 DA H4' H 1 4.464 . . . . . . A 20 DA H4' . 17655 1 170 . 1 1 20 20 DA H5' H 1 4.144 . . . . . . A 20 DA H5' . 17655 1 171 . 1 1 20 20 DA H8 H 1 8.514 . . 1 . . . A 20 DA H8 . 17655 1 172 . 1 1 21 21 DG H1' H 1 6.097 . . . . . . A 21 DG H1' . 17655 1 173 . 1 1 21 21 DG H2' H 1 2.938 . . . . . . A 21 DG H2' . 17655 1 174 . 1 1 21 21 DG H2'' H 1 2.600 . . . . . . A 21 DG H2'' . 17655 1 175 . 1 1 21 21 DG H3' H 1 4.983 . . . . . . A 21 DG H3' . 17655 1 176 . 1 1 21 21 DG H4' H 1 4.408 . . . . . . A 21 DG H4' . 17655 1 177 . 1 1 21 21 DG H5' H 1 4.106 . . . . . . A 21 DG H5' . 17655 1 178 . 1 1 21 21 DG H8 H 1 8.080 . . 1 . . . A 21 DG H8 . 17655 1 179 . 1 1 22 22 DG H1' H 1 6.102 . . . . . . A 22 DG H1' . 17655 1 180 . 1 1 22 22 DG H2' H 1 2.670 . . . . . . A 22 DG H2' . 17655 1 181 . 1 1 22 22 DG H2'' H 1 2.556 . . 2 . . . A 22 DG H2'' . 17655 1 182 . 1 1 22 22 DG H3' H 1 5.014 . . . . . . A 22 DG H3' . 17655 1 183 . 1 1 22 22 DG H4' H 1 4.420 . . . . . . A 22 DG H4' . 17655 1 184 . 1 1 22 22 DG H8 H 1 7.842 . . 1 . . . A 22 DG H8 . 17655 1 185 . 1 1 23 23 DG H1' H 1 6.300 . . . . . . A 23 DG H1' . 17655 1 186 . 1 1 23 23 DG H2' H 1 2.859 . . . . . . A 23 DG H2' . 17655 1 187 . 1 1 23 23 DG H2'' H 1 2.297 . . 2 . . . A 23 DG H2'' . 17655 1 188 . 1 1 23 23 DG H4' H 1 4.320 . . . . . . A 23 DG H4' . 17655 1 189 . 1 1 23 23 DG H8 H 1 7.846 . . 1 . . . A 23 DG H8 . 17655 1 stop_ save_