data_25164 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 25164 _Entry.Title ; NMR structure of the III-IV-V three-way junction from the VS ribozyme and identification of magnesium-binding sites using paramagnetic relaxation enhancement ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2014-08-19 _Entry.Accession_date 2014-08-19 _Entry.Last_release_date 2014-10-14 _Entry.Original_release_date 2014-10-14 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Eric Bonneau . . . 25164 2 Pascale Legault . . . 25164 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 25164 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 'VS ribozyme' . 25164 'Three-way junction' . 25164 'Base triple' . 25164 NMR . 25164 'Mg2+ ions' . 25164 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 25164 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 368 25164 '13C chemical shifts' 286 25164 '15N chemical shifts' 39 25164 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2014-10-14 2014-08-19 original author . 25164 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 2MTK 'BMRB Entry Tracking System' 25164 BMRB 25163 'three-way junction from the VS ribozyme' 25164 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 25164 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI 10.1021/bi500826n _Citation.PubMed_ID 25238589 _Citation.Full_citation . _Citation.Title 'Nuclear Magnetic Resonance Structure of the III-IV-V Three-Way Junction from the Varkud Satellite Ribozyme and Identification of Magnesium-Binding Sites Using Paramagnetic Relaxation Enhancement.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev Biochemistry _Citation.Journal_name_full Biochemistry _Citation.Journal_volume 53 _Citation.Journal_issue 39 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1520-4995 _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 6264 _Citation.Page_last 6275 _Citation.Year 2014 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Eric Bonneau E. . . 25164 1 2 Pascale Legault P. . . 25164 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 25164 _Assembly.ID 1 _Assembly.Name 'three-way junction from the VS ribozyme' _Assembly.BMRB_code . _Assembly.Number_of_components 17 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'RNA (47-MER)' 1 $RNA_(47-MER) A . yes native no no . . . 25164 1 2 'MAGNESIUM ION_1' 2 $entity_MG B . no native no no . . . 25164 1 3 'MAGNESIUM ION_2' 2 $entity_MG C . no native no no . . . 25164 1 4 'MAGNESIUM ION_3' 2 $entity_MG D . no native no no . . . 25164 1 5 'MAGNESIUM ION_4' 2 $entity_MG E . no native no no . . . 25164 1 6 'MAGNESIUM ION_5' 2 $entity_MG F . no native no no . . . 25164 1 7 'MAGNESIUM ION_6' 2 $entity_MG G . no native no no . . . 25164 1 8 water_1 3 $entity_HOH H . no native no no . . . 25164 1 9 water_2 3 $entity_HOH I . no native no no . . . 25164 1 10 water_3 3 $entity_HOH J . no native no no . . . 25164 1 11 water_4 3 $entity_HOH K . no native no no . . . 25164 1 12 water_5 3 $entity_HOH L . no native no no . . . 25164 1 13 water_6 3 $entity_HOH M . no native no no . . . 25164 1 14 water_7 3 $entity_HOH N . no native no no . . . 25164 1 15 water_8 3 $entity_HOH O . no native no no . . . 25164 1 16 water_9 3 $entity_HOH P . no native no no . . . 25164 1 17 water_10 3 $entity_HOH Q . no native no no . . . 25164 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_RNA_(47-MER) _Entity.Sf_category entity _Entity.Sf_framecode RNA_(47-MER) _Entity.Entry_ID 25164 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name RNA_(47-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGACCUCCCGUCCUUGGACG GUCGAGCGAAAGCUUGUGAU UGGUCCG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 47 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 15118.061 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 G . 25164 1 2 2 G . 25164 1 3 3 A . 25164 1 4 4 C . 25164 1 5 5 C . 25164 1 6 6 U . 25164 1 7 7 C . 25164 1 8 8 C . 25164 1 9 9 C . 25164 1 10 10 G . 25164 1 11 11 U . 25164 1 12 12 C . 25164 1 13 13 C . 25164 1 14 14 U . 25164 1 15 15 U . 25164 1 16 16 G . 25164 1 17 17 G . 25164 1 18 18 A . 25164 1 19 19 C . 25164 1 20 20 G . 25164 1 21 21 G . 25164 1 22 22 U . 25164 1 23 23 C . 25164 1 24 24 G . 25164 1 25 25 A . 25164 1 26 26 G . 25164 1 27 27 C . 25164 1 28 28 G . 25164 1 29 29 A . 25164 1 30 30 A . 25164 1 31 31 A . 25164 1 32 32 G . 25164 1 33 33 C . 25164 1 34 34 U . 25164 1 35 35 U . 25164 1 36 36 G . 25164 1 37 37 U . 25164 1 38 38 G . 25164 1 39 39 A . 25164 1 40 40 U . 25164 1 41 41 U . 25164 1 42 42 G . 25164 1 43 43 G . 25164 1 44 44 U . 25164 1 45 45 C . 25164 1 46 46 C . 25164 1 47 47 G . 25164 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 25164 1 . G 2 2 25164 1 . A 3 3 25164 1 . C 4 4 25164 1 . C 5 5 25164 1 . U 6 6 25164 1 . C 7 7 25164 1 . C 8 8 25164 1 . C 9 9 25164 1 . G 10 10 25164 1 . U 11 11 25164 1 . C 12 12 25164 1 . C 13 13 25164 1 . U 14 14 25164 1 . U 15 15 25164 1 . G 16 16 25164 1 . G 17 17 25164 1 . A 18 18 25164 1 . C 19 19 25164 1 . G 20 20 25164 1 . G 21 21 25164 1 . U 22 22 25164 1 . C 23 23 25164 1 . G 24 24 25164 1 . A 25 25 25164 1 . G 26 26 25164 1 . C 27 27 25164 1 . G 28 28 25164 1 . A 29 29 25164 1 . A 30 30 25164 1 . A 31 31 25164 1 . G 32 32 25164 1 . C 33 33 25164 1 . U 34 34 25164 1 . U 35 35 25164 1 . G 36 36 25164 1 . U 37 37 25164 1 . G 38 38 25164 1 . A 39 39 25164 1 . U 40 40 25164 1 . U 41 41 25164 1 . G 42 42 25164 1 . G 43 43 25164 1 . U 44 44 25164 1 . C 45 45 25164 1 . C 46 46 25164 1 . G 47 47 25164 1 stop_ save_ save_entity_MG _Entity.Sf_category entity _Entity.Sf_framecode entity_MG _Entity.Entry_ID 25164 _Entity.ID 2 _Entity.BMRB_code MG _Entity.Name 'MAGNESIUM ION' _Entity.Type non-polymer _Entity.Polymer_common_type . _Entity.Polymer_type . _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code . _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID MG _Entity.Nonpolymer_comp_label $chem_comp_MG _Entity.Number_of_monomers . _Entity.Number_of_nonpolymer_components 1 _Entity.Paramagnetic . _Entity.Thiol_state . _Entity.Src_method . _Entity.Parent_entity_ID 2 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 24.305 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID 'MAGNESIUM ION' BMRB 25164 2 stop_ loop_ _Entity_systematic_name.Name _Entity_systematic_name.Naming_system _Entity_systematic_name.Entry_ID _Entity_systematic_name.Entity_ID 'MAGNESIUM ION' BMRB 25164 2 MG 'Three letter code' 25164 2 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 MG $chem_comp_MG 25164 2 stop_ save_ save_entity_HOH _Entity.Sf_category entity _Entity.Sf_framecode entity_HOH _Entity.Entry_ID 25164 _Entity.ID 3 _Entity.BMRB_code HOH _Entity.Name WATER _Entity.Type water _Entity.Polymer_common_type . _Entity.Polymer_type . _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code . _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID HOH _Entity.Nonpolymer_comp_label $chem_comp_HOH _Entity.Number_of_monomers . _Entity.Number_of_nonpolymer_components 1 _Entity.Paramagnetic . _Entity.Thiol_state . _Entity.Src_method . _Entity.Parent_entity_ID 3 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 18.015 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID WATER BMRB 25164 3 stop_ loop_ _Entity_systematic_name.Name _Entity_systematic_name.Naming_system _Entity_systematic_name.Entry_ID _Entity_systematic_name.Entity_ID WATER BMRB 25164 3 HOH 'Three letter code' 25164 3 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 HOH $chem_comp_HOH 25164 3 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 25164 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $RNA_(47-MER) . 5141 organism . 'Neurospora crassa' ascomycetes . . Eukaryota Fungi Neurospora crassa . . . . . . . . . . . . . . . . . . . . . 25164 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 25164 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $RNA_(47-MER) . 'recombinant technology' 'Escherichia coli' . . . Escherichia coli . . . . . . . . . . . . . . . . pTZ19R . . . . . . 25164 1 stop_ save_ ################################# # Polymer residues and ligands # ################################# save_chem_comp_MG _Chem_comp.Sf_category chem_comp _Chem_comp.Sf_framecode chem_comp_MG _Chem_comp.Entry_ID 25164 _Chem_comp.ID MG _Chem_comp.Provenance PDB _Chem_comp.Name 'MAGNESIUM ION' _Chem_comp.Type NON-POLYMER _Chem_comp.BMRB_code MG _Chem_comp.PDB_code MG _Chem_comp.Ambiguous_flag no _Chem_comp.Initial_date 2012-11-20 _Chem_comp.Modified_date 2012-11-20 _Chem_comp.Release_status REL _Chem_comp.Replaced_by . _Chem_comp.Replaces . _Chem_comp.One_letter_code . _Chem_comp.Three_letter_code MG _Chem_comp.Number_atoms_all 1 _Chem_comp.Number_atoms_nh 1 _Chem_comp.PubChem_code . _Chem_comp.Subcomponent_list . _Chem_comp.InChI_code InChI=1S/Mg/q+2 _Chem_comp.Mon_nstd_flag . _Chem_comp.Mon_nstd_class . _Chem_comp.Mon_nstd_details . _Chem_comp.Mon_nstd_parent . _Chem_comp.Mon_nstd_parent_comp_ID . _Chem_comp.Std_deriv_one_letter_code . _Chem_comp.Std_deriv_three_letter_code . _Chem_comp.Std_deriv_BMRB_code . _Chem_comp.Std_deriv_PDB_code . _Chem_comp.Std_deriv_chem_comp_name . _Chem_comp.Synonyms . _Chem_comp.Formal_charge 2 _Chem_comp.Paramagnetic . _Chem_comp.Aromatic no _Chem_comp.Formula Mg _Chem_comp.Formula_weight 24.305 _Chem_comp.Formula_mono_iso_wt_nat . _Chem_comp.Formula_mono_iso_wt_13C . _Chem_comp.Formula_mono_iso_wt_15N . _Chem_comp.Formula_mono_iso_wt_13C_15N . _Chem_comp.Image_file_name . _Chem_comp.Image_file_format . _Chem_comp.Topo_file_name . _Chem_comp.Topo_file_format . _Chem_comp.Struct_file_name . _Chem_comp.Struct_file_format . _Chem_comp.Stereochem_param_file_name . _Chem_comp.Stereochem_param_file_format . _Chem_comp.Model_details . _Chem_comp.Model_erf . _Chem_comp.Model_source . _Chem_comp.Model_coordinates_details . _Chem_comp.Model_coordinates_missing_flag no _Chem_comp.Ideal_coordinates_details . _Chem_comp.Ideal_coordinates_missing_flag no _Chem_comp.Model_coordinates_db_code . _Chem_comp.Processing_site PDBJ _Chem_comp.Vendor . _Chem_comp.Vendor_product_code . _Chem_comp.Details . _Chem_comp.DB_query_date . _Chem_comp.DB_last_query_revised_last_date . loop_ _Chem_comp_descriptor.Descriptor _Chem_comp_descriptor.Type _Chem_comp_descriptor.Program _Chem_comp_descriptor.Program_version _Chem_comp_descriptor.Entry_ID _Chem_comp_descriptor.Comp_ID InChI=1S/Mg/q+2 InChI InChI 1.03 25164 MG JLVVSXFLKOJNIY-UHFFFAOYSA-N InChIKey InChI 1.03 25164 MG [Mg++] SMILES CACTVS 3.341 25164 MG [Mg++] SMILES_CANONICAL CACTVS 3.341 25164 MG [Mg+2] SMILES ACDLabs 10.04 25164 MG [Mg+2] SMILES 'OpenEye OEToolkits' 1.5.0 25164 MG [Mg+2] SMILES_CANONICAL 'OpenEye OEToolkits' 1.5.0 25164 MG stop_ loop_ _Chem_comp_identifier.Identifier _Chem_comp_identifier.Type _Chem_comp_identifier.Program _Chem_comp_identifier.Program_version _Chem_comp_identifier.Entry_ID _Chem_comp_identifier.Comp_ID magnesium 'SYSTEMATIC NAME' ACDLabs 10.04 25164 MG 'magnesium(+2) cation' 'SYSTEMATIC NAME' 'OpenEye OEToolkits' 1.5.0 25164 MG stop_ loop_ _Chem_comp_atom.Atom_ID _Chem_comp_atom.BMRB_code _Chem_comp_atom.PDB_atom_ID _Chem_comp_atom.Alt_atom_ID _Chem_comp_atom.Auth_atom_ID _Chem_comp_atom.Type_symbol _Chem_comp_atom.Isotope_number _Chem_comp_atom.Chirality _Chem_comp_atom.Stereo_config _Chem_comp_atom.Charge _Chem_comp_atom.Partial_charge _Chem_comp_atom.Oxidation_number _Chem_comp_atom.Unpaired_electron_number _Chem_comp_atom.Align _Chem_comp_atom.Aromatic_flag _Chem_comp_atom.Leaving_atom_flag _Chem_comp_atom.Substruct_code _Chem_comp_atom.Ionizable _Chem_comp_atom.Drawing_2D_coord_x _Chem_comp_atom.Drawing_2D_coord_y _Chem_comp_atom.Model_Cartn_x _Chem_comp_atom.Model_Cartn_x_esd _Chem_comp_atom.Model_Cartn_y _Chem_comp_atom.Model_Cartn_y_esd _Chem_comp_atom.Model_Cartn_z _Chem_comp_atom.Model_Cartn_z_esd _Chem_comp_atom.Model_Cartn_x_ideal _Chem_comp_atom.Model_Cartn_y_ideal _Chem_comp_atom.Model_Cartn_z_ideal _Chem_comp_atom.PDBX_ordinal _Chem_comp_atom.Details _Chem_comp_atom.Entry_ID _Chem_comp_atom.Comp_ID MG MG MG MG . MG . . N 2 . . . 0 no no . . . . 0.000 . 0.000 . 0.000 . 0.000 0.000 0.000 1 . 25164 MG stop_ save_ save_chem_comp_HOH _Chem_comp.Sf_category chem_comp _Chem_comp.Sf_framecode chem_comp_HOH _Chem_comp.Entry_ID 25164 _Chem_comp.ID HOH _Chem_comp.Provenance PDB _Chem_comp.Name WATER _Chem_comp.Type NON-POLYMER _Chem_comp.BMRB_code HOH _Chem_comp.PDB_code HOH _Chem_comp.Ambiguous_flag no _Chem_comp.Initial_date 2012-11-20 _Chem_comp.Modified_date 2012-11-20 _Chem_comp.Release_status REL _Chem_comp.Replaced_by . _Chem_comp.Replaces MTO _Chem_comp.One_letter_code . _Chem_comp.Three_letter_code HOH _Chem_comp.Number_atoms_all 3 _Chem_comp.Number_atoms_nh 1 _Chem_comp.PubChem_code . _Chem_comp.Subcomponent_list . _Chem_comp.InChI_code InChI=1S/H2O/h1H2 _Chem_comp.Mon_nstd_flag . _Chem_comp.Mon_nstd_class . _Chem_comp.Mon_nstd_details . _Chem_comp.Mon_nstd_parent . _Chem_comp.Mon_nstd_parent_comp_ID . _Chem_comp.Std_deriv_one_letter_code . _Chem_comp.Std_deriv_three_letter_code . _Chem_comp.Std_deriv_BMRB_code . _Chem_comp.Std_deriv_PDB_code . _Chem_comp.Std_deriv_chem_comp_name . _Chem_comp.Synonyms . _Chem_comp.Formal_charge 0 _Chem_comp.Paramagnetic . _Chem_comp.Aromatic no _Chem_comp.Formula 'H2 O' _Chem_comp.Formula_weight 18.015 _Chem_comp.Formula_mono_iso_wt_nat . _Chem_comp.Formula_mono_iso_wt_13C . _Chem_comp.Formula_mono_iso_wt_15N . _Chem_comp.Formula_mono_iso_wt_13C_15N . _Chem_comp.Image_file_name . _Chem_comp.Image_file_format . _Chem_comp.Topo_file_name . _Chem_comp.Topo_file_format . _Chem_comp.Struct_file_name . _Chem_comp.Struct_file_format . _Chem_comp.Stereochem_param_file_name . _Chem_comp.Stereochem_param_file_format . _Chem_comp.Model_details . _Chem_comp.Model_erf . _Chem_comp.Model_source . _Chem_comp.Model_coordinates_details . _Chem_comp.Model_coordinates_missing_flag no _Chem_comp.Ideal_coordinates_details . _Chem_comp.Ideal_coordinates_missing_flag no _Chem_comp.Model_coordinates_db_code 1NHE _Chem_comp.Processing_site RCSB _Chem_comp.Vendor . _Chem_comp.Vendor_product_code . _Chem_comp.Details . _Chem_comp.DB_query_date . _Chem_comp.DB_last_query_revised_last_date . loop_ _Chem_comp_descriptor.Descriptor _Chem_comp_descriptor.Type _Chem_comp_descriptor.Program _Chem_comp_descriptor.Program_version _Chem_comp_descriptor.Entry_ID _Chem_comp_descriptor.Comp_ID InChI=1S/H2O/h1H2 InChI InChI 1.03 25164 HOH O SMILES ACDLabs 10.04 25164 HOH O SMILES CACTVS 3.341 25164 HOH O SMILES 'OpenEye OEToolkits' 1.5.0 25164 HOH O SMILES_CANONICAL CACTVS 3.341 25164 HOH O SMILES_CANONICAL 'OpenEye OEToolkits' 1.5.0 25164 HOH XLYOFNOQVPJJNP-UHFFFAOYSA-N InChIKey InChI 1.03 25164 HOH stop_ loop_ _Chem_comp_identifier.Identifier _Chem_comp_identifier.Type _Chem_comp_identifier.Program _Chem_comp_identifier.Program_version _Chem_comp_identifier.Entry_ID _Chem_comp_identifier.Comp_ID oxidane 'SYSTEMATIC NAME' 'OpenEye OEToolkits' 1.5.0 25164 HOH water 'SYSTEMATIC NAME' ACDLabs 10.04 25164 HOH stop_ loop_ _Chem_comp_atom.Atom_ID _Chem_comp_atom.BMRB_code _Chem_comp_atom.PDB_atom_ID _Chem_comp_atom.Alt_atom_ID _Chem_comp_atom.Auth_atom_ID _Chem_comp_atom.Type_symbol _Chem_comp_atom.Isotope_number _Chem_comp_atom.Chirality _Chem_comp_atom.Stereo_config _Chem_comp_atom.Charge _Chem_comp_atom.Partial_charge _Chem_comp_atom.Oxidation_number _Chem_comp_atom.Unpaired_electron_number _Chem_comp_atom.Align _Chem_comp_atom.Aromatic_flag _Chem_comp_atom.Leaving_atom_flag _Chem_comp_atom.Substruct_code _Chem_comp_atom.Ionizable _Chem_comp_atom.Drawing_2D_coord_x _Chem_comp_atom.Drawing_2D_coord_y _Chem_comp_atom.Model_Cartn_x _Chem_comp_atom.Model_Cartn_x_esd _Chem_comp_atom.Model_Cartn_y _Chem_comp_atom.Model_Cartn_y_esd _Chem_comp_atom.Model_Cartn_z _Chem_comp_atom.Model_Cartn_z_esd _Chem_comp_atom.Model_Cartn_x_ideal _Chem_comp_atom.Model_Cartn_y_ideal _Chem_comp_atom.Model_Cartn_z_ideal _Chem_comp_atom.PDBX_ordinal _Chem_comp_atom.Details _Chem_comp_atom.Entry_ID _Chem_comp_atom.Comp_ID O O O O . O . . N 0 . . . 1 no no . . . . -23.107 . 18.401 . -21.626 . -0.064 0.000 0.000 1 . 25164 HOH H1 H1 H1 1H . H . . N 0 . . . 1 no no . . . . -22.157 . 18.401 . -21.626 . 0.512 0.000 -0.776 2 . 25164 HOH H2 H2 H2 2H . H . . N 0 . . . 1 no no . . . . -23.424 . 18.401 . -20.730 . 0.512 0.000 0.776 3 . 25164 HOH stop_ loop_ _Chem_comp_bond.ID _Chem_comp_bond.Type _Chem_comp_bond.Value_order _Chem_comp_bond.Atom_ID_1 _Chem_comp_bond.Atom_ID_2 _Chem_comp_bond.Aromatic_flag _Chem_comp_bond.Stereo_config _Chem_comp_bond.Ordinal _Chem_comp_bond.Details _Chem_comp_bond.Entry_ID _Chem_comp_bond.Comp_ID 1 . SING O H1 no N 1 . 25164 HOH 2 . SING O H2 no N 2 . 25164 HOH stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_J345-1 _Sample.Sf_category sample _Sample.Sf_framecode J345-1 _Sample.Entry_ID 25164 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 J345-1 '[U-100% 15N]' . . 1 $RNA_(47-MER) . . . 1.5 2.0 mM . . . . 25164 1 2 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 25164 1 3 MgCl2 'natural abundance' . . . . . . 5 . . mM . . . . 25164 1 4 H2O 'natural abundance' . . . . . . 90 . . % . . . . 25164 1 5 D2O 'natural abundance' . . . . . . 10 . . % . . . . 25164 1 stop_ save_ save_J345-2 _Sample.Sf_category sample _Sample.Sf_framecode J345-2 _Sample.Entry_ID 25164 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 J345-2 '[U-100% 13C; U-100% 15N]' . . 1 $RNA_(47-MER) . . 2.0 . . mM . . . . 25164 2 2 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 25164 2 3 MgCl2 'natural abundance' . . . . . . 5 . . mM . . . . 25164 2 4 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25164 2 stop_ save_ save_J345-3 _Sample.Sf_category sample _Sample.Sf_framecode J345-3 _Sample.Entry_ID 25164 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 J345-3 '[U-100% 13C; U-100% 15N]' . . 1 $RNA_(47-MER) . . 2.0 . . mM . . . . 25164 3 2 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 25164 3 3 MgCl2 'natural abundance' . . . . . . 5 . . mM . . . . 25164 3 4 H2O 'natural abundance' . . . . . . 90 . . % . . . . 25164 3 5 D2O 'natural abundance' . . . . . . 10 . . % . . . . 25164 3 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 25164 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID temperature 288 . K 25164 1 pH 6.5 . pH 25164 1 'ionic strength' 55 . mM 25164 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 25164 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID temperature 298 . K 25164 2 pH 6.5 . pH 25164 2 'ionic strength' 55 . mM 25164 2 stop_ save_ ############################ # Computer software used # ############################ save_NMRDraw _Software.Sf_category software _Software.Sf_framecode NMRDraw _Software.Entry_ID 25164 _Software.ID 1 _Software.Name NMRDraw _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 25164 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'data analysis' 25164 1 processing 25164 1 stop_ save_ save_NMRPipe _Software.Sf_category software _Software.Sf_framecode NMRPipe _Software.Entry_ID 25164 _Software.ID 2 _Software.Name NMRPipe _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 25164 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'data analysis' 25164 2 processing 25164 2 stop_ save_ save_CCPNMR_suite _Software.Sf_category software _Software.Sf_framecode CCPNMR_suite _Software.Entry_ID 25164 _Software.ID 3 _Software.Name CCPNMR_suite _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID CCPN . . 25164 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 25164 3 'data analysis' 25164 3 'peak picking' 25164 3 stop_ save_ save_X-PLOR_NIH _Software.Sf_category software _Software.Sf_framecode X-PLOR_NIH _Software.Entry_ID 25164 _Software.ID 4 _Software.Name X-PLOR_NIH _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 25164 4 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 25164 4 refinement 25164 4 stop_ save_ save_PyMol _Software.Sf_category software _Software.Sf_framecode PyMol _Software.Entry_ID 25164 _Software.ID 5 _Software.Name PyMol _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Schrodinger . . 25164 5 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'Structure analysis' 25164 5 'Structure display' 25164 5 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 25164 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Varian _NMR_spectrometer.Model Unity _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 25164 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Varian Unity . 600 . . . 25164 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 25164 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '1D flip-back watergate 1H' no . . . . . . . . . . 1 $J345-1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 2 '2D 1H-15N HSQC' no . . . . . . . . . . 1 $J345-1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 3 '2D 1H-15N HSQC NH2 only' no . . . . . . . . . . 1 $J345-1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 4 '3D 1H-15N NOESY' no . . . . . . . . . . 1 $J345-1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 5 '2D 1H-13C HSQC' no . . . . . . . . . . 2 $J345-2 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 6 '3D 13C-edited HMQC-NOESY' no . . . . . . . . . . 2 $J345-2 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 7 '3D CT-HCCH-COSY' no . . . . . . . . . . 2 $J345-2 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 8 '3D HCCH-TOCSY' no . . . . . . . . . . 2 $J345-2 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 9 '3D 15N-edited NOESY-HSQC' no . . . . . . . . . . 3 $J345-3 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 10 '2D H(NC)-TOCSY-(C)H for guanosine residues' no . . . . . . . . . . 3 $J345-3 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 11 '2D 1H-13C HMQC' no . . . . . . . . . . 2 $J345-2 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 12 '2D 1H-15N MQ-(HC)N(C)H' no . . . . . . . . . . 2 $J345-2 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 13 '2D 1H-15N CPMG-NOESY' no . . . . . . . . . . 1 $J345-1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 14 '2D HNN-COSY' no . . . . . . . . . . 1 $J345-1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 25164 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 25164 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . . . . . 25164 1 C 13 DSS 'methyl protons' . . . . ppm 0.00 na indirect 0.251449530 . . . . . . . . . 25164 1 N 15 DSS 'methyl protons' . . . . ppm 0.00 na indirect 0.101329118 . . . . . . . . . 25164 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 25164 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 2 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_2 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 2 '2D 1H-15N HSQC' . . . 25164 1 3 '2D 1H-15N HSQC NH2 only' . . . 25164 1 5 '2D 1H-13C HSQC' . . . 25164 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.982 0.2 . 1 . . . A 1 G H1' . 25164 1 2 . 1 1 1 1 G H2' H 1 4.693 0.2 . 1 . . . A 1 G H2' . 25164 1 3 . 1 1 1 1 G H3' H 1 4.980 0.2 . 1 . . . A 1 G H3' . 25164 1 4 . 1 1 1 1 G H4' H 1 4.453 0.2 . 1 . . . A 1 G H4' . 25164 1 5 . 1 1 1 1 G H5' H 1 4.449 0.2 . 1 . . . A 1 G H5' . 25164 1 6 . 1 1 1 1 G H5'' H 1 4.097 0.2 . 1 . . . A 1 G H5'' . 25164 1 7 . 1 1 1 1 G H8 H 1 7.535 0.01 . 1 . . . A 1 G H8 . 25164 1 8 . 1 1 1 1 G C1' C 13 91.754 0.01 . 1 . . . A 1 G C1' . 25164 1 9 . 1 1 1 1 G C2' C 13 84.749 0.01 . 1 . . . A 1 G C2' . 25164 1 10 . 1 1 1 1 G C3' C 13 78.533 0.01 . 1 . . . A 1 G C3' . 25164 1 11 . 1 1 1 1 G C4' C 13 86.229 0.01 . 2 . . . A 1 G C4' . 25164 1 12 . 1 1 1 1 G C5' C 13 65.947 0.01 . 2 . . . A 1 G C5' . 25164 1 13 . 1 1 1 1 G C8 C 13 137.976 0.01 . 1 . . . A 1 G C8 . 25164 1 14 . 1 1 2 2 G H1 H 1 12.461 0.2 . 1 . . . A 2 G H1 . 25164 1 15 . 1 1 2 2 G H1' H 1 5.840 0.2 . 1 . . . A 2 G H1' . 25164 1 16 . 1 1 2 2 G H2' H 1 4.587 0.2 . 1 . . . A 2 G H2' . 25164 1 17 . 1 1 2 2 G H3' H 1 4.692 0.2 . 1 . . . A 2 G H3' . 25164 1 18 . 1 1 2 2 G H8 H 1 7.522 0.02 . 1 . . . A 2 G H8 . 25164 1 19 . 1 1 2 2 G C1' C 13 92.897 0.01 . 1 . . . A 2 G C1' . 25164 1 20 . 1 1 2 2 G C2' C 13 75.426 0.01 . 1 . . . A 2 G C2' . 25164 1 21 . 1 1 2 2 G C3' C 13 72.652 0.01 . 1 . . . A 2 G C3' . 25164 1 22 . 1 1 2 2 G C8 C 13 136.793 0.01 . 1 . . . A 2 G C8 . 25164 1 23 . 1 1 2 2 G N1 N 15 147.323 0.1 . 1 . . . A 2 G N1 . 25164 1 24 . 1 1 3 3 A H1' H 1 6.015 0.2 . 1 . . . A 3 A H1' . 25164 1 25 . 1 1 3 3 A H2 H 1 7.835 0.2 . 1 . . . A 3 A H2 . 25164 1 26 . 1 1 3 3 A H2' H 1 4.505 0.2 . 1 . . . A 3 A H2' . 25164 1 27 . 1 1 3 3 A H3' H 1 4.660 0.2 . 1 . . . A 3 A H3' . 25164 1 28 . 1 1 3 3 A H8 H 1 7.884 0.2 . 1 . . . A 3 A H8 . 25164 1 29 . 1 1 3 3 A C1' C 13 92.726 0.01 . 1 . . . A 3 A C1' . 25164 1 30 . 1 1 3 3 A C2 C 13 154.265 0.01 . 1 . . . A 3 A C2 . 25164 1 31 . 1 1 3 3 A C2' C 13 75.628 0.01 . 1 . . . A 3 A C2' . 25164 1 32 . 1 1 3 3 A C3' C 13 72.512 0.01 . 1 . . . A 3 A C3' . 25164 1 33 . 1 1 3 3 A C8 C 13 139.311 0.01 . 1 . . . A 3 A C8 . 25164 1 34 . 1 1 4 4 C H1' H 1 5.458 0.2 . 1 . . . A 4 C H1' . 25164 1 35 . 1 1 4 4 C H2' H 1 4.277 0.2 . 1 . . . A 4 C H2' . 25164 1 36 . 1 1 4 4 C H3' H 1 4.385 0.2 . 1 . . . A 4 C H3' . 25164 1 37 . 1 1 4 4 C H4' H 1 4.400 0.2 . 1 . . . A 4 C H4' . 25164 1 38 . 1 1 4 4 C H5 H 1 5.188 0.2 . 1 . . . A 4 C H5 . 25164 1 39 . 1 1 4 4 C H6 H 1 7.499 0.2 . 1 . . . A 4 C H6 . 25164 1 40 . 1 1 4 4 C H41 H 1 6.902 0.01 . 1 . . . A 4 C H41 . 25164 1 41 . 1 1 4 4 C H42 H 1 8.539 0.01 . 1 . . . A 4 C H42 . 25164 1 42 . 1 1 4 4 C C1' C 13 93.490 0.01 . 1 . . . A 4 C C1' . 25164 1 43 . 1 1 4 4 C C2' C 13 75.660 0.01 . 1 . . . A 4 C C2' . 25164 1 44 . 1 1 4 4 C C3' C 13 72.298 0.02 . 1 . . . A 4 C C3' . 25164 1 45 . 1 1 4 4 C C4' C 13 81.858 0.02 . 1 . . . A 4 C C4' . 25164 1 46 . 1 1 4 4 C C5 C 13 97.185 0.01 . 1 . . . A 4 C C5 . 25164 1 47 . 1 1 4 4 C C6 C 13 140.691 0.01 . 1 . . . A 4 C C6 . 25164 1 48 . 1 1 4 4 C N4 N 15 99.169 0.1 . 1 . . . A 4 C N4 . 25164 1 49 . 1 1 5 5 C H1' H 1 5.505 0.2 . 1 . . . A 5 C H1' . 25164 1 50 . 1 1 5 5 C H2' H 1 4.569 0.2 . 1 . . . A 5 C H2' . 25164 1 51 . 1 1 5 5 C H5 H 1 5.453 0.2 . 1 . . . A 5 C H5 . 25164 1 52 . 1 1 5 5 C H6 H 1 7.606 0.2 . 1 . . . A 5 C H6 . 25164 1 53 . 1 1 5 5 C H41 H 1 6.675 0.01 . 1 . . . A 5 C H41 . 25164 1 54 . 1 1 5 5 C H42 H 1 8.287 0.01 . 1 . . . A 5 C H42 . 25164 1 55 . 1 1 5 5 C C1' C 13 93.954 0.02 . 1 . . . A 5 C C1' . 25164 1 56 . 1 1 5 5 C C2' C 13 75.470 0.02 . 1 . . . A 5 C C2' . 25164 1 57 . 1 1 5 5 C C5 C 13 98.146 0.01 . 1 . . . A 5 C C5 . 25164 1 58 . 1 1 5 5 C C6 C 13 141.104 0.01 . 1 . . . A 5 C C6 . 25164 1 59 . 1 1 5 5 C N4 N 15 98.567 0.1 . 1 . . . A 5 C N4 . 25164 1 60 . 1 1 6 6 U H1' H 1 5.601 0.2 . 1 . . . A 6 U H1' . 25164 1 61 . 1 1 6 6 U H2' H 1 4.613 0.2 . 1 . . . A 6 U H2' . 25164 1 62 . 1 1 6 6 U H3 H 1 11.358 0.2 . 1 . . . A 6 U H3 . 25164 1 63 . 1 1 6 6 U H3' H 1 4.340 0.2 . 1 . . . A 6 U H3' . 25164 1 64 . 1 1 6 6 U H4' H 1 4.418 0.2 . 1 . . . A 6 U H4' . 25164 1 65 . 1 1 6 6 U H5 H 1 5.582 0.2 . 1 . . . A 6 U H5 . 25164 1 66 . 1 1 6 6 U H5' H 1 4.557 0.2 . 1 . . . A 6 U H5' . 25164 1 67 . 1 1 6 6 U H5'' H 1 4.118 0.01 . 1 . . . A 6 U H5'' . 25164 1 68 . 1 1 6 6 U H6 H 1 7.756 0.01 . 1 . . . A 6 U H6 . 25164 1 69 . 1 1 6 6 U C1' C 13 94.651 0.02 . 1 . . . A 6 U C1' . 25164 1 70 . 1 1 6 6 U C2' C 13 75.219 0.01 . 1 . . . A 6 U C2' . 25164 1 71 . 1 1 6 6 U C3' C 13 71.948 0.01 . 1 . . . A 6 U C3' . 25164 1 72 . 1 1 6 6 U C4' C 13 83.009 0.01 . 1 . . . A 6 U C4' . 25164 1 73 . 1 1 6 6 U C5 C 13 104.784 0.01 . 2 . . . A 6 U C5 . 25164 1 74 . 1 1 6 6 U C5' C 13 64.440 0.01 . 2 . . . A 6 U C5' . 25164 1 75 . 1 1 6 6 U C6 C 13 140.587 0.01 . 1 . . . A 6 U C6 . 25164 1 76 . 1 1 6 6 U N3 N 15 157.756 0.1 . 1 . . . A 6 U N3 . 25164 1 77 . 1 1 7 7 C H1' H 1 5.358 0.2 . 1 . . . A 7 C H1' . 25164 1 78 . 1 1 7 7 C H2' H 1 3.865 0.2 . 1 . . . A 7 C H2' . 25164 1 79 . 1 1 7 7 C H3' H 1 4.576 0.2 . 1 . . . A 7 C H3' . 25164 1 80 . 1 1 7 7 C H4' H 1 4.327 0.2 . 1 . . . A 7 C H4' . 25164 1 81 . 1 1 7 7 C H5 H 1 5.905 0.2 . 1 . . . A 7 C H5 . 25164 1 82 . 1 1 7 7 C H6 H 1 8.241 0.2 . 1 . . . A 7 C H6 . 25164 1 83 . 1 1 7 7 C H41 H 1 6.665 0.01 . 1 . . . A 7 C H41 . 25164 1 84 . 1 1 7 7 C H42 H 1 7.201 0.01 . 1 . . . A 7 C H42 . 25164 1 85 . 1 1 7 7 C C1' C 13 93.881 0.01 . 1 . . . A 7 C C1' . 25164 1 86 . 1 1 7 7 C C2' C 13 76.211 0.01 . 1 . . . A 7 C C2' . 25164 1 87 . 1 1 7 7 C C3' C 13 71.727 0.02 . 1 . . . A 7 C C3' . 25164 1 88 . 1 1 7 7 C C4' C 13 82.027 0.02 . 1 . . . A 7 C C4' . 25164 1 89 . 1 1 7 7 C C5 C 13 98.542 0.01 . 1 . . . A 7 C C5 . 25164 1 90 . 1 1 7 7 C C6 C 13 141.857 0.01 . 1 . . . A 7 C C6 . 25164 1 91 . 1 1 7 7 C N4 N 15 97.644 0.1 . 1 . . . A 7 C N4 . 25164 1 92 . 1 1 8 8 C H1' H 1 4.819 0.2 . 1 . . . A 8 C H1' . 25164 1 93 . 1 1 8 8 C H2' H 1 4.147 0.2 . 1 . . . A 8 C H2' . 25164 1 94 . 1 1 8 8 C H3' H 1 4.584 0.2 . 1 . . . A 8 C H3' . 25164 1 95 . 1 1 8 8 C H4' H 1 4.267 0.2 . 1 . . . A 8 C H4' . 25164 1 96 . 1 1 8 8 C H5 H 1 5.644 0.2 . 1 . . . A 8 C H5 . 25164 1 97 . 1 1 8 8 C H6 H 1 7.952 0.2 . 1 . . . A 8 C H6 . 25164 1 98 . 1 1 8 8 C H41 H 1 6.973 0.01 . 1 . . . A 8 C H41 . 25164 1 99 . 1 1 8 8 C H42 H 1 7.946 0.01 . 1 . . . A 8 C H42 . 25164 1 100 . 1 1 8 8 C C1' C 13 93.295 0.01 . 1 . . . A 8 C C1' . 25164 1 101 . 1 1 8 8 C C2' C 13 75.609 0.01 . 1 . . . A 8 C C2' . 25164 1 102 . 1 1 8 8 C C3' C 13 71.726 0.02 . 1 . . . A 8 C C3' . 25164 1 103 . 1 1 8 8 C C4' C 13 82.182 0.02 . 1 . . . A 8 C C4' . 25164 1 104 . 1 1 8 8 C C5 C 13 97.187 0.01 . 1 . . . A 8 C C5 . 25164 1 105 . 1 1 8 8 C C6 C 13 141.847 0.01 . 1 . . . A 8 C C6 . 25164 1 106 . 1 1 8 8 C N4 N 15 98.281 0.1 . 1 . . . A 8 C N4 . 25164 1 107 . 1 1 9 9 C H1' H 1 6.211 0.2 . 1 . . . A 9 C H1' . 25164 1 108 . 1 1 9 9 C H2' H 1 4.729 0.2 . 1 . . . A 9 C H2' . 25164 1 109 . 1 1 9 9 C H3' H 1 4.720 0.2 . 1 . . . A 9 C H3' . 25164 1 110 . 1 1 9 9 C H4' H 1 4.669 0.2 . 1 . . . A 9 C H4' . 25164 1 111 . 1 1 9 9 C H5 H 1 5.453 0.2 . 1 . . . A 9 C H5 . 25164 1 112 . 1 1 9 9 C H5' H 1 4.589 0.2 . 1 . . . A 9 C H5' . 25164 1 113 . 1 1 9 9 C H5'' H 1 4.167 0.2 . 1 . . . A 9 C H5'' . 25164 1 114 . 1 1 9 9 C H6 H 1 7.993 0.01 . 1 . . . A 9 C H6 . 25164 1 115 . 1 1 9 9 C H41 H 1 6.478 0.01 . 1 . . . A 9 C H41 . 25164 1 116 . 1 1 9 9 C H42 H 1 8.280 0.01 . 1 . . . A 9 C H42 . 25164 1 117 . 1 1 9 9 C C1' C 13 93.684 0.01 . 1 . . . A 9 C C1' . 25164 1 118 . 1 1 9 9 C C2' C 13 74.645 0.02 . 1 . . . A 9 C C2' . 25164 1 119 . 1 1 9 9 C C3' C 13 71.729 0.02 . 1 . . . A 9 C C3' . 25164 1 120 . 1 1 9 9 C C4' C 13 82.026 0.01 . 1 . . . A 9 C C4' . 25164 1 121 . 1 1 9 9 C C5 C 13 97.567 0.01 . 2 . . . A 9 C C5 . 25164 1 122 . 1 1 9 9 C C5' C 13 64.348 0.01 . 2 . . . A 9 C C5' . 25164 1 123 . 1 1 9 9 C C6 C 13 141.428 0.01 . 1 . . . A 9 C C6 . 25164 1 124 . 1 1 9 9 C N4 N 15 97.316 0.1 . 1 . . . A 9 C N4 . 25164 1 125 . 1 1 10 10 G H1 H 1 12.727 0.2 . 1 . . . A 10 G H1 . 25164 1 126 . 1 1 10 10 G H1' H 1 5.648 0.2 . 1 . . . A 10 G H1' . 25164 1 127 . 1 1 10 10 G H2' H 1 4.387 0.2 . 1 . . . A 10 G H2' . 25164 1 128 . 1 1 10 10 G H3' H 1 4.680 0.2 . 1 . . . A 10 G H3' . 25164 1 129 . 1 1 10 10 G H4' H 1 4.344 0.2 . 1 . . . A 10 G H4' . 25164 1 130 . 1 1 10 10 G H5' H 1 4.107 0.2 . 1 . . . A 10 G H5' . 25164 1 131 . 1 1 10 10 G H5'' H 1 4.532 0.02 . 1 . . . A 10 G H5'' . 25164 1 132 . 1 1 10 10 G H8 H 1 7.557 0.01 . 1 . . . A 10 G H8 . 25164 1 133 . 1 1 10 10 G C1' C 13 91.851 0.01 . 1 . . . A 10 G C1' . 25164 1 134 . 1 1 10 10 G C2' C 13 75.605 0.01 . 1 . . . A 10 G C2' . 25164 1 135 . 1 1 10 10 G C3' C 13 72.520 0.01 . 1 . . . A 10 G C3' . 25164 1 136 . 1 1 10 10 G C4' C 13 82.020 0.01 . 2 . . . A 10 G C4' . 25164 1 137 . 1 1 10 10 G C5' C 13 64.754 0.01 . 2 . . . A 10 G C5' . 25164 1 138 . 1 1 10 10 G C8 C 13 136.194 0.01 . 1 . . . A 10 G C8 . 25164 1 139 . 1 1 10 10 G N1 N 15 146.766 0.1 . 1 . . . A 10 G N1 . 25164 1 140 . 1 1 11 11 U H1' H 1 5.542 0.2 . 1 . . . A 11 U H1' . 25164 1 141 . 1 1 11 11 U H2' H 1 4.385 0.2 . 1 . . . A 11 U H2' . 25164 1 142 . 1 1 11 11 U H3 H 1 14.261 0.2 . 1 . . . A 11 U H3 . 25164 1 143 . 1 1 11 11 U H3' H 1 4.452 0.2 . 1 . . . A 11 U H3' . 25164 1 144 . 1 1 11 11 U H5 H 1 5.137 0.2 . 1 . . . A 11 U H5 . 25164 1 145 . 1 1 11 11 U H5' H 1 4.500 0.2 . 1 . . . A 11 U H5' . 25164 1 146 . 1 1 11 11 U H5'' H 1 4.104 0.01 . 1 . . . A 11 U H5'' . 25164 1 147 . 1 1 11 11 U H6 H 1 7.816 0.01 . 1 . . . A 11 U H6 . 25164 1 148 . 1 1 11 11 U C1' C 13 93.385 0.02 . 1 . . . A 11 U C1' . 25164 1 149 . 1 1 11 11 U C2' C 13 75.418 0.01 . 1 . . . A 11 U C2' . 25164 1 150 . 1 1 11 11 U C3' C 13 72.391 0.01 . 1 . . . A 11 U C3' . 25164 1 151 . 1 1 11 11 U C5 C 13 102.516 0.01 . 2 . . . A 11 U C5 . 25164 1 152 . 1 1 11 11 U C5' C 13 64.152 0.01 . 2 . . . A 11 U C5' . 25164 1 153 . 1 1 11 11 U C6 C 13 142.238 0.01 . 1 . . . A 11 U C6 . 25164 1 154 . 1 1 11 11 U N3 N 15 162.482 0.1 . 1 . . . A 11 U N3 . 25164 1 155 . 1 1 12 12 C H1' H 1 5.630 0.2 . 1 . . . A 12 C H1' . 25164 1 156 . 1 1 12 12 C H2' H 1 4.183 0.2 . 1 . . . A 12 C H2' . 25164 1 157 . 1 1 12 12 C H3' H 1 4.666 0.2 . 1 . . . A 12 C H3' . 25164 1 158 . 1 1 12 12 C H4' H 1 4.510 0.2 . 1 . . . A 12 C H4' . 25164 1 159 . 1 1 12 12 C H5 H 1 5.573 0.2 . 1 . . . A 12 C H5 . 25164 1 160 . 1 1 12 12 C H6 H 1 7.805 0.2 . 1 . . . A 12 C H6 . 25164 1 161 . 1 1 12 12 C H41 H 1 6.868 0.01 . 1 . . . A 12 C H41 . 25164 1 162 . 1 1 12 12 C H42 H 1 8.465 0.01 . 1 . . . A 12 C H42 . 25164 1 163 . 1 1 12 12 C C1' C 13 93.594 0.01 . 1 . . . A 12 C C1' . 25164 1 164 . 1 1 12 12 C C2' C 13 77.022 0.01 . 1 . . . A 12 C C2' . 25164 1 165 . 1 1 12 12 C C3' C 13 72.570 0.02 . 1 . . . A 12 C C3' . 25164 1 166 . 1 1 12 12 C C4' C 13 82.135 0.02 . 1 . . . A 12 C C4' . 25164 1 167 . 1 1 12 12 C C5 C 13 97.550 0.01 . 1 . . . A 12 C C5 . 25164 1 168 . 1 1 12 12 C C6 C 13 141.284 0.01 . 1 . . . A 12 C C6 . 25164 1 169 . 1 1 12 12 C N4 N 15 99.207 0.1 . 1 . . . A 12 C N4 . 25164 1 170 . 1 1 13 13 C H1' H 1 5.564 0.2 . 1 . . . A 13 C H1' . 25164 1 171 . 1 1 13 13 C H2' H 1 4.379 0.2 . 1 . . . A 13 C H2' . 25164 1 172 . 1 1 13 13 C H3' H 1 4.406 0.2 . 1 . . . A 13 C H3' . 25164 1 173 . 1 1 13 13 C H5 H 1 5.694 0.2 . 1 . . . A 13 C H5 . 25164 1 174 . 1 1 13 13 C H6 H 1 7.648 0.2 . 1 . . . A 13 C H6 . 25164 1 175 . 1 1 13 13 C H41 H 1 6.702 0.01 . 1 . . . A 13 C H41 . 25164 1 176 . 1 1 13 13 C H42 H 1 8.291 0.01 . 1 . . . A 13 C H42 . 25164 1 177 . 1 1 13 13 C C1' C 13 93.895 0.01 . 1 . . . A 13 C C1' . 25164 1 178 . 1 1 13 13 C C2' C 13 76.779 0.02 . 1 . . . A 13 C C2' . 25164 1 179 . 1 1 13 13 C C3' C 13 72.259 0.02 . 1 . . . A 13 C C3' . 25164 1 180 . 1 1 13 13 C C5 C 13 98.353 0.01 . 1 . . . A 13 C C5 . 25164 1 181 . 1 1 13 13 C C6 C 13 141.465 0.01 . 1 . . . A 13 C C6 . 25164 1 182 . 1 1 13 13 C N4 N 15 97.850 0.1 . 1 . . . A 13 C N4 . 25164 1 183 . 1 1 14 14 U H1' H 1 5.909 0.2 . 1 . . . A 14 U H1' . 25164 1 184 . 1 1 14 14 U H2' H 1 4.384 0.2 . 1 . . . A 14 U H2' . 25164 1 185 . 1 1 14 14 U H3 H 1 11.124 0.2 . 1 . . . A 14 U H3 . 25164 1 186 . 1 1 14 14 U H4' H 1 4.157 0.2 . 1 . . . A 14 U H4' . 25164 1 187 . 1 1 14 14 U H5 H 1 5.786 0.2 . 1 . . . A 14 U H5 . 25164 1 188 . 1 1 14 14 U H5' H 1 3.962 0.2 . 1 . . . A 14 U H5' . 25164 1 189 . 1 1 14 14 U H5'' H 1 4.145 0.01 . 1 . . . A 14 U H5'' . 25164 1 190 . 1 1 14 14 U H6 H 1 7.981 0.01 . 1 . . . A 14 U H6 . 25164 1 191 . 1 1 14 14 U C1' C 13 90.386 0.02 . 2 . . . A 14 U C1' . 25164 1 192 . 1 1 14 14 U C2' C 13 75.076 0.01 . 1 . . . A 14 U C2' . 25164 1 193 . 1 1 14 14 U C4' C 13 85.337 0.01 . 1 . . . A 14 U C4' . 25164 1 194 . 1 1 14 14 U C5 C 13 104.784 0.01 . 2 . . . A 14 U C5 . 25164 1 195 . 1 1 14 14 U C5' C 13 66.590 0.01 . 2 . . . A 14 U C5' . 25164 1 196 . 1 1 14 14 U C6 C 13 143.839 0.01 . 1 . . . A 14 U C6 . 25164 1 197 . 1 1 14 14 U N3 N 15 157.562 0.1 . 2 . . . A 14 U N3 . 25164 1 198 . 1 1 15 15 U H1' H 1 5.644 0.2 . 1 . . . A 15 U H1' . 25164 1 199 . 1 1 15 15 U H2' H 1 4.149 0.2 . 1 . . . A 15 U H2' . 25164 1 200 . 1 1 15 15 U H3 H 1 10.100 0.2 . 1 . . . A 15 U H3 . 25164 1 201 . 1 1 15 15 U H3' H 1 4.516 0.2 . 1 . . . A 15 U H3' . 25164 1 202 . 1 1 15 15 U H4' H 1 4.055 0.2 . 1 . . . A 15 U H4' . 25164 1 203 . 1 1 15 15 U H5 H 1 5.664 0.2 . 1 . . . A 15 U H5 . 25164 1 204 . 1 1 15 15 U H5' H 1 3.385 0.2 . 1 . . . A 15 U H5' . 25164 1 205 . 1 1 15 15 U H5'' H 1 3.715 0.01 . 1 . . . A 15 U H5'' . 25164 1 206 . 1 1 15 15 U H6 H 1 7.540 0.01 . 1 . . . A 15 U H6 . 25164 1 207 . 1 1 15 15 U C1' C 13 89.602 0.02 . 2 . . . A 15 U C1' . 25164 1 208 . 1 1 15 15 U C2' C 13 76.399 0.01 . 1 . . . A 15 U C2' . 25164 1 209 . 1 1 15 15 U C3' C 13 78.728 0.01 . 1 . . . A 15 U C3' . 25164 1 210 . 1 1 15 15 U C4' C 13 85.140 0.01 . 1 . . . A 15 U C4' . 25164 1 211 . 1 1 15 15 U C5 C 13 104.757 0.01 . 2 . . . A 15 U C5 . 25164 1 212 . 1 1 15 15 U C5' C 13 67.274 0.01 . 2 . . . A 15 U C5' . 25164 1 213 . 1 1 15 15 U C6 C 13 143.455 0.01 . 1 . . . A 15 U C6 . 25164 1 214 . 1 1 15 15 U N3 N 15 155.022 0.1 . 2 . . . A 15 U N3 . 25164 1 215 . 1 1 16 16 G H1 H 1 12.508 0.2 . 1 . . . A 16 G H1 . 25164 1 216 . 1 1 16 16 G H1' H 1 5.884 0.2 . 1 . . . A 16 G H1' . 25164 1 217 . 1 1 16 16 G H2' H 1 4.877 0.2 . 1 . . . A 16 G H2' . 25164 1 218 . 1 1 16 16 G H3' H 1 4.623 0.2 . 1 . . . A 16 G H3' . 25164 1 219 . 1 1 16 16 G H4' H 1 4.452 0.2 . 1 . . . A 16 G H4' . 25164 1 220 . 1 1 16 16 G H5' H 1 4.134 0.2 . 1 . . . A 16 G H5' . 25164 1 221 . 1 1 16 16 G H5'' H 1 3.968 0.02 . 1 . . . A 16 G H5'' . 25164 1 222 . 1 1 16 16 G H8 H 1 8.122 0.01 . 1 . . . A 16 G H8 . 25164 1 223 . 1 1 16 16 G C1' C 13 93.061 0.01 . 1 . . . A 16 G C1' . 25164 1 224 . 1 1 16 16 G C2' C 13 75.231 0.01 . 1 . . . A 16 G C2' . 25164 1 225 . 1 1 16 16 G C3' C 13 73.870 0.01 . 1 . . . A 16 G C3' . 25164 1 226 . 1 1 16 16 G C4' C 13 84.439 0.01 . 2 . . . A 16 G C4' . 25164 1 227 . 1 1 16 16 G C5' C 13 62.581 0.01 . 2 . . . A 16 G C5' . 25164 1 228 . 1 1 16 16 G C8 C 13 138.364 0.01 . 1 . . . A 16 G C8 . 25164 1 229 . 1 1 16 16 G N1 N 15 147.349 0.1 . 1 . . . A 16 G N1 . 25164 1 230 . 1 1 17 17 G H1 H 1 12.545 0.2 . 1 . . . A 17 G H1 . 25164 1 231 . 1 1 17 17 G H1' H 1 5.979 0.2 . 1 . . . A 17 G H1' . 25164 1 232 . 1 1 17 17 G H2' H 1 4.815 0.2 . 1 . . . A 17 G H2' . 25164 1 233 . 1 1 17 17 G H3' H 1 5.382 0.2 . 1 . . . A 17 G H3' . 25164 1 234 . 1 1 17 17 G H4' H 1 4.433 0.2 . 1 . . . A 17 G H4' . 25164 1 235 . 1 1 17 17 G H5' H 1 4.336 0.2 . 1 . . . A 17 G H5' . 25164 1 236 . 1 1 17 17 G H5'' H 1 4.549 0.02 . 1 . . . A 17 G H5'' . 25164 1 237 . 1 1 17 17 G H8 H 1 8.211 0.01 . 1 . . . A 17 G H8 . 25164 1 238 . 1 1 17 17 G C1' C 13 91.532 0.01 . 1 . . . A 17 G C1' . 25164 1 239 . 1 1 17 17 G C2' C 13 76.591 0.01 . 1 . . . A 17 G C2' . 25164 1 240 . 1 1 17 17 G C3' C 13 76.191 0.01 . 1 . . . A 17 G C3' . 25164 1 241 . 1 1 17 17 G C4' C 13 83.972 0.01 . 2 . . . A 17 G C4' . 25164 1 242 . 1 1 17 17 G C5' C 13 69.788 0.01 . 2 . . . A 17 G C5' . 25164 1 243 . 1 1 17 17 G C8 C 13 138.752 0.01 . 1 . . . A 17 G C8 . 25164 1 244 . 1 1 17 17 G N1 N 15 147.267 0.1 . 1 . . . A 17 G N1 . 25164 1 245 . 1 1 18 18 A H1' H 1 6.013 0.2 . 1 . . . A 18 A H1' . 25164 1 246 . 1 1 18 18 A H2 H 1 7.766 0.2 . 1 . . . A 18 A H2 . 25164 1 247 . 1 1 18 18 A H2' H 1 4.440 0.2 . 1 . . . A 18 A H2' . 25164 1 248 . 1 1 18 18 A H3' H 1 4.716 0.2 . 1 . . . A 18 A H3' . 25164 1 249 . 1 1 18 18 A H8 H 1 8.010 0.2 . 1 . . . A 18 A H8 . 25164 1 250 . 1 1 18 18 A C1' C 13 92.721 0.01 . 1 . . . A 18 A C1' . 25164 1 251 . 1 1 18 18 A C2 C 13 154.282 0.01 . 1 . . . A 18 A C2 . 25164 1 252 . 1 1 18 18 A C2' C 13 75.539 0.01 . 1 . . . A 18 A C2' . 25164 1 253 . 1 1 18 18 A C3' C 13 72.528 0.01 . 1 . . . A 18 A C3' . 25164 1 254 . 1 1 18 18 A C8 C 13 139.715 0.01 . 1 . . . A 18 A C8 . 25164 1 255 . 1 1 19 19 C H1' H 1 5.482 0.2 . 1 . . . A 19 C H1' . 25164 1 256 . 1 1 19 19 C H2' H 1 4.424 0.2 . 1 . . . A 19 C H2' . 25164 1 257 . 1 1 19 19 C H3' H 1 4.494 0.2 . 1 . . . A 19 C H3' . 25164 1 258 . 1 1 19 19 C H4' H 1 4.398 0.2 . 1 . . . A 19 C H4' . 25164 1 259 . 1 1 19 19 C H5 H 1 5.167 0.2 . 1 . . . A 19 C H5 . 25164 1 260 . 1 1 19 19 C H5' H 1 4.536 0.2 . 1 . . . A 19 C H5' . 25164 1 261 . 1 1 19 19 C H5'' H 1 4.089 0.2 . 1 . . . A 19 C H5'' . 25164 1 262 . 1 1 19 19 C H6 H 1 7.565 0.01 . 1 . . . A 19 C H6 . 25164 1 263 . 1 1 19 19 C H41 H 1 6.701 0.01 . 1 . . . A 19 C H41 . 25164 1 264 . 1 1 19 19 C H42 H 1 8.103 0.01 . 1 . . . A 19 C H42 . 25164 1 265 . 1 1 19 19 C C1' C 13 92.982 0.01 . 1 . . . A 19 C C1' . 25164 1 266 . 1 1 19 19 C C2' C 13 75.497 0.02 . 1 . . . A 19 C C2' . 25164 1 267 . 1 1 19 19 C C3' C 13 72.503 0.02 . 1 . . . A 19 C C3' . 25164 1 268 . 1 1 19 19 C C4' C 13 81.293 0.01 . 1 . . . A 19 C C4' . 25164 1 269 . 1 1 19 19 C C5 C 13 97.763 0.01 . 2 . . . A 19 C C5 . 25164 1 270 . 1 1 19 19 C C5' C 13 64.292 0.01 . 2 . . . A 19 C C5' . 25164 1 271 . 1 1 19 19 C C6 C 13 139.917 0.01 . 1 . . . A 19 C C6 . 25164 1 272 . 1 1 19 19 C N4 N 15 98.802 0.1 . 1 . . . A 19 C N4 . 25164 1 273 . 1 1 20 20 G H1 H 1 13.100 0.2 . 1 . . . A 20 G H1 . 25164 1 274 . 1 1 20 20 G H1' H 1 5.767 0.2 . 1 . . . A 20 G H1' . 25164 1 275 . 1 1 20 20 G H2' H 1 4.778 0.2 . 1 . . . A 20 G H2' . 25164 1 276 . 1 1 20 20 G H3' H 1 4.512 0.2 . 1 . . . A 20 G H3' . 25164 1 277 . 1 1 20 20 G H4' H 1 4.315 0.2 . 1 . . . A 20 G H4' . 25164 1 278 . 1 1 20 20 G H5' H 1 4.132 0.2 . 1 . . . A 20 G H5' . 25164 1 279 . 1 1 20 20 G H5'' H 1 4.505 0.02 . 1 . . . A 20 G H5'' . 25164 1 280 . 1 1 20 20 G H8 H 1 7.546 0.01 . 1 . . . A 20 G H8 . 25164 1 281 . 1 1 20 20 G C1' C 13 92.338 0.01 . 1 . . . A 20 G C1' . 25164 1 282 . 1 1 20 20 G C2' C 13 75.426 0.01 . 1 . . . A 20 G C2' . 25164 1 283 . 1 1 20 20 G C3' C 13 73.270 0.01 . 1 . . . A 20 G C3' . 25164 1 284 . 1 1 20 20 G C4' C 13 83.490 0.01 . 2 . . . A 20 G C4' . 25164 1 285 . 1 1 20 20 G C5' C 13 65.511 0.01 . 2 . . . A 20 G C5' . 25164 1 286 . 1 1 20 20 G C8 C 13 135.867 0.01 . 1 . . . A 20 G C8 . 25164 1 287 . 1 1 20 20 G N1 N 15 147.383 0.1 . 1 . . . A 20 G N1 . 25164 1 288 . 1 1 21 21 G H1 H 1 13.971 0.2 . 1 . . . A 21 G H1 . 25164 1 289 . 1 1 21 21 G H1' H 1 5.969 0.2 . 1 . . . A 21 G H1' . 25164 1 290 . 1 1 21 21 G H2' H 1 4.576 0.2 . 1 . . . A 21 G H2' . 25164 1 291 . 1 1 21 21 G H3' H 1 4.361 0.2 . 1 . . . A 21 G H3' . 25164 1 292 . 1 1 21 21 G H4' H 1 4.573 0.2 . 1 . . . A 21 G H4' . 25164 1 293 . 1 1 21 21 G H5' H 1 4.076 0.2 . 1 . . . A 21 G H5' . 25164 1 294 . 1 1 21 21 G H5'' H 1 4.583 0.02 . 1 . . . A 21 G H5'' . 25164 1 295 . 1 1 21 21 G H8 H 1 7.243 0.01 . 1 . . . A 21 G H8 . 25164 1 296 . 1 1 21 21 G H21 H 1 7.883 0.01 . 1 . . . A 21 G H21 . 25164 1 297 . 1 1 21 21 G H22 H 1 7.093 0.01 . 1 . . . A 21 G H22 . 25164 1 298 . 1 1 21 21 G C1' C 13 93.683 0.01 . 1 . . . A 21 G C1' . 25164 1 299 . 1 1 21 21 G C2' C 13 74.700 0.01 . 1 . . . A 21 G C2' . 25164 1 300 . 1 1 21 21 G C3' C 13 72.887 0.01 . 1 . . . A 21 G C3' . 25164 1 301 . 1 1 21 21 G C4' C 13 82.011 0.01 . 2 . . . A 21 G C4' . 25164 1 302 . 1 1 21 21 G C5' C 13 65.041 0.01 . 2 . . . A 21 G C5' . 25164 1 303 . 1 1 21 21 G C8 C 13 136.451 0.01 . 1 . . . A 21 G C8 . 25164 1 304 . 1 1 21 21 G N1 N 15 149.573 0.1 . 1 . . . A 21 G N1 . 25164 1 305 . 1 1 21 21 G N2 N 15 75.048 0.1 . 1 . . . A 21 G N2 . 25164 1 306 . 1 1 22 22 U H1' H 1 3.690 0.2 . 1 . . . A 22 U H1' . 25164 1 307 . 1 1 22 22 U H2' H 1 4.117 0.2 . 1 . . . A 22 U H2' . 25164 1 308 . 1 1 22 22 U H3 H 1 10.766 0.2 . 1 . . . A 22 U H3 . 25164 1 309 . 1 1 22 22 U H3' H 1 3.698 0.2 . 1 . . . A 22 U H3' . 25164 1 310 . 1 1 22 22 U H4' H 1 3.691 0.2 . 1 . . . A 22 U H4' . 25164 1 311 . 1 1 22 22 U H5 H 1 5.082 0.2 . 1 . . . A 22 U H5 . 25164 1 312 . 1 1 22 22 U H5' H 1 3.815 0.2 . 1 . . . A 22 U H5' . 25164 1 313 . 1 1 22 22 U H5'' H 1 4.308 0.01 . 1 . . . A 22 U H5'' . 25164 1 314 . 1 1 22 22 U H6 H 1 6.928 0.01 . 1 . . . A 22 U H6 . 25164 1 315 . 1 1 22 22 U C1' C 13 94.456 0.02 . 1 . . . A 22 U C1' . 25164 1 316 . 1 1 22 22 U C2' C 13 73.864 0.01 . 1 . . . A 22 U C2' . 25164 1 317 . 1 1 22 22 U C3' C 13 72.497 0.01 . 1 . . . A 22 U C3' . 25164 1 318 . 1 1 22 22 U C4' C 13 81.274 0.01 . 1 . . . A 22 U C4' . 25164 1 319 . 1 1 22 22 U C5 C 13 102.851 0.01 . 2 . . . A 22 U C5 . 25164 1 320 . 1 1 22 22 U C5' C 13 64.930 0.01 . 2 . . . A 22 U C5' . 25164 1 321 . 1 1 22 22 U C6 C 13 140.872 0.01 . 1 . . . A 22 U C6 . 25164 1 322 . 1 1 22 22 U N3 N 15 159.598 0.1 . 1 . . . A 22 U N3 . 25164 1 323 . 1 1 23 23 C H1' H 1 5.587 0.2 . 1 . . . A 23 C H1' . 25164 1 324 . 1 1 23 23 C H2' H 1 4.652 0.2 . 1 . . . A 23 C H2' . 25164 1 325 . 1 1 23 23 C H3' H 1 4.381 0.2 . 1 . . . A 23 C H3' . 25164 1 326 . 1 1 23 23 C H4' H 1 4.449 0.2 . 1 . . . A 23 C H4' . 25164 1 327 . 1 1 23 23 C H5 H 1 5.664 0.2 . 1 . . . A 23 C H5 . 25164 1 328 . 1 1 23 23 C H5' H 1 4.485 0.2 . 1 . . . A 23 C H5' . 25164 1 329 . 1 1 23 23 C H5'' H 1 4.177 0.2 . 1 . . . A 23 C H5'' . 25164 1 330 . 1 1 23 23 C H6 H 1 7.812 0.01 . 1 . . . A 23 C H6 . 25164 1 331 . 1 1 23 23 C C1' C 13 93.511 0.01 . 1 . . . A 23 C C1' . 25164 1 332 . 1 1 23 23 C C2' C 13 74.871 0.01 . 1 . . . A 23 C C2' . 25164 1 333 . 1 1 23 23 C C3' C 13 72.299 0.01 . 1 . . . A 23 C C3' . 25164 1 334 . 1 1 23 23 C C4' C 13 82.089 0.01 . 1 . . . A 23 C C4' . 25164 1 335 . 1 1 23 23 C C5 C 13 97.971 0.01 . 2 . . . A 23 C C5 . 25164 1 336 . 1 1 23 23 C C5' C 13 64.672 0.01 . 2 . . . A 23 C C5' . 25164 1 337 . 1 1 23 23 C C6 C 13 141.452 0.01 . 1 . . . A 23 C C6 . 25164 1 338 . 1 1 24 24 G H1 H 1 10.405 0.2 . 1 . . . A 24 G H1 . 25164 1 339 . 1 1 24 24 G H1' H 1 5.841 0.2 . 1 . . . A 24 G H1' . 25164 1 340 . 1 1 24 24 G H2' H 1 4.826 0.2 . 1 . . . A 24 G H2' . 25164 1 341 . 1 1 24 24 G H3' H 1 4.683 0.2 . 1 . . . A 24 G H3' . 25164 1 342 . 1 1 24 24 G H4' H 1 4.490 0.2 . 1 . . . A 24 G H4' . 25164 1 343 . 1 1 24 24 G H5' H 1 4.257 0.2 . 1 . . . A 24 G H5' . 25164 1 344 . 1 1 24 24 G H5'' H 1 4.632 0.02 . 1 . . . A 24 G H5'' . 25164 1 345 . 1 1 24 24 G H8 H 1 8.116 0.01 . 1 . . . A 24 G H8 . 25164 1 346 . 1 1 24 24 G C1' C 13 92.901 0.01 . 1 . . . A 24 G C1' . 25164 1 347 . 1 1 24 24 G C2' C 13 75.416 0.01 . 1 . . . A 24 G C2' . 25164 1 348 . 1 1 24 24 G C3' C 13 72.125 0.01 . 1 . . . A 24 G C3' . 25164 1 349 . 1 1 24 24 G C4' C 13 82.613 0.01 . 2 . . . A 24 G C4' . 25164 1 350 . 1 1 24 24 G C5' C 13 65.130 0.01 . 2 . . . A 24 G C5' . 25164 1 351 . 1 1 24 24 G C8 C 13 138.768 0.01 . 1 . . . A 24 G C8 . 25164 1 352 . 1 1 24 24 G N1 N 15 141.598 0.1 . 1 . . . A 24 G N1 . 25164 1 353 . 1 1 25 25 A H1' H 1 5.979 0.2 . 1 . . . A 25 A H1' . 25164 1 354 . 1 1 25 25 A H2 H 1 7.508 0.2 . 1 . . . A 25 A H2 . 25164 1 355 . 1 1 25 25 A H2' H 1 4.650 0.2 . 1 . . . A 25 A H2' . 25164 1 356 . 1 1 25 25 A H3' H 1 4.687 0.2 . 1 . . . A 25 A H3' . 25164 1 357 . 1 1 25 25 A H4' H 1 4.573 0.2 . 1 . . . A 25 A H4' . 25164 1 358 . 1 1 25 25 A H5' H 1 4.177 0.2 . 1 . . . A 25 A H5' . 25164 1 359 . 1 1 25 25 A H5'' H 1 4.511 0.2 . 1 . . . A 25 A H5'' . 25164 1 360 . 1 1 25 25 A H8 H 1 7.676 0.01 . 1 . . . A 25 A H8 . 25164 1 361 . 1 1 25 25 A C1' C 13 93.102 0.01 . 1 . . . A 25 A C1' . 25164 1 362 . 1 1 25 25 A C2 C 13 153.511 0.01 . 1 . . . A 25 A C2 . 25164 1 363 . 1 1 25 25 A C2' C 13 75.613 0.01 . 1 . . . A 25 A C2' . 25164 1 364 . 1 1 25 25 A C3' C 13 72.565 0.01 . 1 . . . A 25 A C3' . 25164 1 365 . 1 1 25 25 A C4' C 13 81.666 0.01 . 2 . . . A 25 A C4' . 25164 1 366 . 1 1 25 25 A C5' C 13 65.035 0.01 . 2 . . . A 25 A C5' . 25164 1 367 . 1 1 25 25 A C8 C 13 139.341 0.01 . 1 . . . A 25 A C8 . 25164 1 368 . 1 1 26 26 G H1 H 1 13.311 0.2 . 1 . . . A 26 G H1 . 25164 1 369 . 1 1 26 26 G H1' H 1 5.783 0.2 . 1 . . . A 26 G H1' . 25164 1 370 . 1 1 26 26 G H2' H 1 4.389 0.2 . 1 . . . A 26 G H2' . 25164 1 371 . 1 1 26 26 G H3' H 1 4.509 0.2 . 1 . . . A 26 G H3' . 25164 1 372 . 1 1 26 26 G H4' H 1 4.508 0.2 . 1 . . . A 26 G H4' . 25164 1 373 . 1 1 26 26 G H5' H 1 4.510 0.2 . 1 . . . A 26 G H5' . 25164 1 374 . 1 1 26 26 G H5'' H 1 4.103 0.02 . 1 . . . A 26 G H5'' . 25164 1 375 . 1 1 26 26 G H8 H 1 7.290 0.01 . 1 . . . A 26 G H8 . 25164 1 376 . 1 1 26 26 G C1' C 13 92.703 0.01 . 1 . . . A 26 G C1' . 25164 1 377 . 1 1 26 26 G C2' C 13 75.246 0.01 . 1 . . . A 26 G C2' . 25164 1 378 . 1 1 26 26 G C3' C 13 72.124 0.01 . 1 . . . A 26 G C3' . 25164 1 379 . 1 1 26 26 G C4' C 13 81.948 0.01 . 2 . . . A 26 G C4' . 25164 1 380 . 1 1 26 26 G C5' C 13 64.889 0.01 . 2 . . . A 26 G C5' . 25164 1 381 . 1 1 26 26 G C8 C 13 135.833 0.01 . 1 . . . A 26 G C8 . 25164 1 382 . 1 1 26 26 G N1 N 15 148.047 0.1 . 1 . . . A 26 G N1 . 25164 1 383 . 1 1 27 27 C H1' H 1 5.636 0.2 . 1 . . . A 27 C H1' . 25164 1 384 . 1 1 27 27 C H2' H 1 4.469 0.2 . 1 . . . A 27 C H2' . 25164 1 385 . 1 1 27 27 C H3' H 1 4.503 0.2 . 1 . . . A 27 C H3' . 25164 1 386 . 1 1 27 27 C H4' H 1 4.389 0.2 . 1 . . . A 27 C H4' . 25164 1 387 . 1 1 27 27 C H5 H 1 5.103 0.2 . 1 . . . A 27 C H5 . 25164 1 388 . 1 1 27 27 C H5' H 1 4.542 0.2 . 1 . . . A 27 C H5' . 25164 1 389 . 1 1 27 27 C H5'' H 1 4.129 0.2 . 1 . . . A 27 C H5'' . 25164 1 390 . 1 1 27 27 C H6 H 1 7.446 0.01 . 1 . . . A 27 C H6 . 25164 1 391 . 1 1 27 27 C H41 H 1 6.501 0.01 . 1 . . . A 27 C H41 . 25164 1 392 . 1 1 27 27 C H42 H 1 8.293 0.01 . 1 . . . A 27 C H42 . 25164 1 393 . 1 1 27 27 C C1' C 13 93.429 0.01 . 1 . . . A 27 C C1' . 25164 1 394 . 1 1 27 27 C C2' C 13 76.008 0.02 . 1 . . . A 27 C C2' . 25164 1 395 . 1 1 27 27 C C3' C 13 71.664 0.02 . 1 . . . A 27 C C3' . 25164 1 396 . 1 1 27 27 C C4' C 13 81.865 0.01 . 1 . . . A 27 C C4' . 25164 1 397 . 1 1 27 27 C C5 C 13 97.952 0.01 . 2 . . . A 27 C C5 . 25164 1 398 . 1 1 27 27 C C5' C 13 64.682 0.01 . 2 . . . A 27 C C5' . 25164 1 399 . 1 1 27 27 C C6 C 13 139.528 0.01 . 1 . . . A 27 C C6 . 25164 1 400 . 1 1 27 27 C N4 N 15 98.935 0.1 . 1 . . . A 27 C N4 . 25164 1 401 . 1 1 28 28 G H1 H 1 10.635 0.2 . 1 . . . A 28 G H1 . 25164 1 402 . 1 1 28 28 G H1' H 1 5.774 0.2 . 1 . . . A 28 G H1' . 25164 1 403 . 1 1 28 28 G H2' H 1 4.322 0.2 . 1 . . . A 28 G H2' . 25164 1 404 . 1 1 28 28 G H3' H 1 4.700 0.2 . 1 . . . A 28 G H3' . 25164 1 405 . 1 1 28 28 G H4' H 1 4.421 0.2 . 1 . . . A 28 G H4' . 25164 1 406 . 1 1 28 28 G H5' H 1 4.547 0.2 . 1 . . . A 28 G H5' . 25164 1 407 . 1 1 28 28 G H5'' H 1 4.098 0.02 . 1 . . . A 28 G H5'' . 25164 1 408 . 1 1 28 28 G H8 H 1 7.554 0.01 . 1 . . . A 28 G H8 . 25164 1 409 . 1 1 28 28 G C1' C 13 93.876 0.01 . 1 . . . A 28 G C1' . 25164 1 410 . 1 1 28 28 G C2' C 13 75.922 0.01 . 1 . . . A 28 G C2' . 25164 1 411 . 1 1 28 28 G C3' C 13 71.719 0.01 . 1 . . . A 28 G C3' . 25164 1 412 . 1 1 28 28 G C4' C 13 81.841 0.01 . 2 . . . A 28 G C4' . 25164 1 413 . 1 1 28 28 G C5' C 13 65.019 0.01 . 2 . . . A 28 G C5' . 25164 1 414 . 1 1 28 28 G C8 C 13 136.500 0.01 . 1 . . . A 28 G C8 . 25164 1 415 . 1 1 28 28 G N1 N 15 146.111 0.1 . 1 . . . A 28 G N1 . 25164 1 416 . 1 1 29 29 A H1' H 1 5.668 0.2 . 1 . . . A 29 A H1' . 25164 1 417 . 1 1 29 29 A H2 H 1 7.737 0.2 . 1 . . . A 29 A H2 . 25164 1 418 . 1 1 29 29 A H2' H 1 4.802 0.2 . 1 . . . A 29 A H2' . 25164 1 419 . 1 1 29 29 A H3' H 1 4.457 0.2 . 1 . . . A 29 A H3' . 25164 1 420 . 1 1 29 29 A H4' H 1 4.241 0.2 . 1 . . . A 29 A H4' . 25164 1 421 . 1 1 29 29 A H5' H 1 4.304 0.2 . 1 . . . A 29 A H5' . 25164 1 422 . 1 1 29 29 A H5'' H 1 3.950 0.2 . 1 . . . A 29 A H5'' . 25164 1 423 . 1 1 29 29 A H8 H 1 8.347 0.01 . 1 . . . A 29 A H8 . 25164 1 424 . 1 1 29 29 A H61 H 1 6.345 0.01 . 1 . . . A 29 A H61 . 25164 1 425 . 1 1 29 29 A C1' C 13 93.276 0.01 . 1 . . . A 29 A C1' . 25164 1 426 . 1 1 29 29 A C2 C 13 153.919 0.01 . 1 . . . A 29 A C2 . 25164 1 427 . 1 1 29 29 A C2' C 13 75.421 0.01 . 1 . . . A 29 A C2' . 25164 1 428 . 1 1 29 29 A C3' C 13 72.147 0.01 . 2 . . . A 29 A C3' . 25164 1 429 . 1 1 29 29 A C4' C 13 82.994 0.01 . 2 . . . A 29 A C4' . 25164 1 430 . 1 1 29 29 A C5' C 13 63.503 0.02 . 1 . . . A 29 A C5' . 25164 1 431 . 1 1 29 29 A C8 C 13 142.246 0.01 . 1 . . . A 29 A C8 . 25164 1 432 . 1 1 29 29 A N6 N 15 78.928 0.1 . 1 . . . A 29 A N6 . 25164 1 433 . 1 1 30 30 A H1' H 1 5.387 0.2 . 1 . . . A 30 A H1' . 25164 1 434 . 1 1 30 30 A H2 H 1 7.738 0.2 . 1 . . . A 30 A H2 . 25164 1 435 . 1 1 30 30 A H2' H 1 4.363 0.2 . 1 . . . A 30 A H2' . 25164 1 436 . 1 1 30 30 A H3' H 1 4.619 0.2 . 1 . . . A 30 A H3' . 25164 1 437 . 1 1 30 30 A H4' H 1 4.364 0.2 . 1 . . . A 30 A H4' . 25164 1 438 . 1 1 30 30 A H5' H 1 4.196 0.2 . 1 . . . A 30 A H5' . 25164 1 439 . 1 1 30 30 A H5'' H 1 4.342 0.2 . 1 . . . A 30 A H5'' . 25164 1 440 . 1 1 30 30 A H8 H 1 7.935 0.01 . 1 . . . A 30 A H8 . 25164 1 441 . 1 1 30 30 A H61 H 1 6.327 0.01 . 1 . . . A 30 A H61 . 25164 1 442 . 1 1 30 30 A C1' C 13 93.103 0.01 . 1 . . . A 30 A C1' . 25164 1 443 . 1 1 30 30 A C2 C 13 154.474 0.01 . 1 . . . A 30 A C2 . 25164 1 444 . 1 1 30 30 A C2' C 13 75.606 0.01 . 1 . . . A 30 A C2' . 25164 1 445 . 1 1 30 30 A C3' C 13 73.080 0.01 . 2 . . . A 30 A C3' . 25164 1 446 . 1 1 30 30 A C4' C 13 83.015 0.01 . 2 . . . A 30 A C4' . 25164 1 447 . 1 1 30 30 A C5' C 13 69.032 0.02 . 1 . . . A 30 A C5' . 25164 1 448 . 1 1 30 30 A C8 C 13 139.923 0.01 . 1 . . . A 30 A C8 . 25164 1 449 . 1 1 30 30 A N6 N 15 80.579 0.1 . 1 . . . A 30 A N6 . 25164 1 450 . 1 1 31 31 A H1' H 1 5.977 0.2 . 1 . . . A 31 A H1' . 25164 1 451 . 1 1 31 31 A H2 H 1 8.209 0.2 . 1 . . . A 31 A H2 . 25164 1 452 . 1 1 31 31 A H2' H 1 4.652 0.2 . 1 . . . A 31 A H2' . 25164 1 453 . 1 1 31 31 A H3' H 1 4.925 0.2 . 1 . . . A 31 A H3' . 25164 1 454 . 1 1 31 31 A H4' H 1 4.457 0.2 . 1 . . . A 31 A H4' . 25164 1 455 . 1 1 31 31 A H8 H 1 8.223 0.2 . 1 . . . A 31 A H8 . 25164 1 456 . 1 1 31 31 A C1' C 13 91.755 0.01 . 1 . . . A 31 A C1' . 25164 1 457 . 1 1 31 31 A C2 C 13 155.843 0.01 . 1 . . . A 31 A C2 . 25164 1 458 . 1 1 31 31 A C2' C 13 76.207 0.01 . 1 . . . A 31 A C2' . 25164 1 459 . 1 1 31 31 A C3' C 13 72.902 0.01 . 1 . . . A 31 A C3' . 25164 1 460 . 1 1 31 31 A C4' C 13 81.903 0.01 . 1 . . . A 31 A C4' . 25164 1 461 . 1 1 31 31 A C8 C 13 140.133 0.01 . 1 . . . A 31 A C8 . 25164 1 462 . 1 1 32 32 G H1 H 1 12.975 0.2 . 1 . . . A 32 G H1 . 25164 1 463 . 1 1 32 32 G H1' H 1 3.410 0.2 . 1 . . . A 32 G H1' . 25164 1 464 . 1 1 32 32 G H2' H 1 4.249 0.2 . 1 . . . A 32 G H2' . 25164 1 465 . 1 1 32 32 G H3' H 1 4.144 0.2 . 1 . . . A 32 G H3' . 25164 1 466 . 1 1 32 32 G H4' H 1 4.321 0.2 . 1 . . . A 32 G H4' . 25164 1 467 . 1 1 32 32 G H5' H 1 4.235 0.2 . 1 . . . A 32 G H5' . 25164 1 468 . 1 1 32 32 G H5'' H 1 4.330 0.02 . 1 . . . A 32 G H5'' . 25164 1 469 . 1 1 32 32 G H8 H 1 7.950 0.01 . 1 . . . A 32 G H8 . 25164 1 470 . 1 1 32 32 G C1' C 13 93.096 0.01 . 1 . . . A 32 G C1' . 25164 1 471 . 1 1 32 32 G C2' C 13 74.651 0.01 . 1 . . . A 32 G C2' . 25164 1 472 . 1 1 32 32 G C3' C 13 74.645 0.01 . 1 . . . A 32 G C3' . 25164 1 473 . 1 1 32 32 G C4' C 13 82.195 0.01 . 2 . . . A 32 G C4' . 25164 1 474 . 1 1 32 32 G C5' C 13 69.405 0.01 . 2 . . . A 32 G C5' . 25164 1 475 . 1 1 32 32 G C8 C 13 137.318 0.01 . 1 . . . A 32 G C8 . 25164 1 476 . 1 1 32 32 G N1 N 15 148.085 0.1 . 1 . . . A 32 G N1 . 25164 1 477 . 1 1 33 33 C H1' H 1 5.557 0.2 . 1 . . . A 33 C H1' . 25164 1 478 . 1 1 33 33 C H2' H 1 4.443 0.2 . 1 . . . A 33 C H2' . 25164 1 479 . 1 1 33 33 C H3' H 1 4.443 0.2 . 1 . . . A 33 C H3' . 25164 1 480 . 1 1 33 33 C H4' H 1 4.263 0.2 . 1 . . . A 33 C H4' . 25164 1 481 . 1 1 33 33 C H5 H 1 5.195 0.2 . 1 . . . A 33 C H5 . 25164 1 482 . 1 1 33 33 C H5' H 1 4.576 0.2 . 1 . . . A 33 C H5' . 25164 1 483 . 1 1 33 33 C H5'' H 1 4.144 0.2 . 1 . . . A 33 C H5'' . 25164 1 484 . 1 1 33 33 C H6 H 1 7.719 0.01 . 1 . . . A 33 C H6 . 25164 1 485 . 1 1 33 33 C H41 H 1 6.746 0.01 . 1 . . . A 33 C H41 . 25164 1 486 . 1 1 33 33 C H42 H 1 8.677 0.01 . 1 . . . A 33 C H42 . 25164 1 487 . 1 1 33 33 C C1' C 13 93.893 0.01 . 1 . . . A 33 C C1' . 25164 1 488 . 1 1 33 33 C C2' C 13 75.381 0.02 . 1 . . . A 33 C C2' . 25164 1 489 . 1 1 33 33 C C3' C 13 72.249 0.02 . 1 . . . A 33 C C3' . 25164 1 490 . 1 1 33 33 C C4' C 13 82.613 0.01 . 1 . . . A 33 C C4' . 25164 1 491 . 1 1 33 33 C C5 C 13 96.790 0.01 . 2 . . . A 33 C C5 . 25164 1 492 . 1 1 33 33 C C5' C 13 64.864 0.01 . 2 . . . A 33 C C5' . 25164 1 493 . 1 1 33 33 C C6 C 13 141.517 0.01 . 1 . . . A 33 C C6 . 25164 1 494 . 1 1 33 33 C N4 N 15 98.495 0.1 . 1 . . . A 33 C N4 . 25164 1 495 . 1 1 34 34 U H1' H 1 5.856 0.2 . 1 . . . A 34 U H1' . 25164 1 496 . 1 1 34 34 U H2' H 1 4.767 0.2 . 1 . . . A 34 U H2' . 25164 1 497 . 1 1 34 34 U H3 H 1 13.935 0.2 . 1 . . . A 34 U H3 . 25164 1 498 . 1 1 34 34 U H3' H 1 4.233 0.2 . 1 . . . A 34 U H3' . 25164 1 499 . 1 1 34 34 U H4' H 1 4.410 0.2 . 1 . . . A 34 U H4' . 25164 1 500 . 1 1 34 34 U H5 H 1 5.456 0.2 . 1 . . . A 34 U H5 . 25164 1 501 . 1 1 34 34 U H5' H 1 4.122 0.2 . 1 . . . A 34 U H5' . 25164 1 502 . 1 1 34 34 U H5'' H 1 4.565 0.01 . 1 . . . A 34 U H5'' . 25164 1 503 . 1 1 34 34 U H6 H 1 7.891 0.01 . 1 . . . A 34 U H6 . 25164 1 504 . 1 1 34 34 U C1' C 13 90.962 0.02 . 1 . . . A 34 U C1' . 25164 1 505 . 1 1 34 34 U C2' C 13 75.721 0.01 . 1 . . . A 34 U C2' . 25164 1 506 . 1 1 34 34 U C3' C 13 72.314 0.01 . 1 . . . A 34 U C3' . 25164 1 507 . 1 1 34 34 U C4' C 13 79.953 0.01 . 1 . . . A 34 U C4' . 25164 1 508 . 1 1 34 34 U C5 C 13 103.582 0.01 . 2 . . . A 34 U C5 . 25164 1 509 . 1 1 34 34 U C5' C 13 64.183 0.01 . 2 . . . A 34 U C5' . 25164 1 510 . 1 1 34 34 U C6 C 13 141.843 0.01 . 1 . . . A 34 U C6 . 25164 1 511 . 1 1 34 34 U N3 N 15 161.829 0.1 . 1 . . . A 34 U N3 . 25164 1 512 . 1 1 35 35 U H1' H 1 5.373 0.2 . 1 . . . A 35 U H1' . 25164 1 513 . 1 1 35 35 U H2' H 1 4.357 0.2 . 1 . . . A 35 U H2' . 25164 1 514 . 1 1 35 35 U H3 H 1 11.445 0.2 . 1 . . . A 35 U H3 . 25164 1 515 . 1 1 35 35 U H3' H 1 4.516 0.2 . 1 . . . A 35 U H3' . 25164 1 516 . 1 1 35 35 U H4' H 1 4.353 0.2 . 1 . . . A 35 U H4' . 25164 1 517 . 1 1 35 35 U H5 H 1 5.856 0.2 . 1 . . . A 35 U H5 . 25164 1 518 . 1 1 35 35 U H5'' H 1 4.309 0.2 . 1 . . . A 35 U H5'' . 25164 1 519 . 1 1 35 35 U H6 H 1 7.919 0.01 . 1 . . . A 35 U H6 . 25164 1 520 . 1 1 35 35 U C1' C 13 94.274 0.01 . 1 . . . A 35 U C1' . 25164 1 521 . 1 1 35 35 U C2' C 13 75.612 0.02 . 1 . . . A 35 U C2' . 25164 1 522 . 1 1 35 35 U C3' C 13 72.920 0.01 . 1 . . . A 35 U C3' . 25164 1 523 . 1 1 35 35 U C4' C 13 82.804 0.01 . 1 . . . A 35 U C4' . 25164 1 524 . 1 1 35 35 U C5 C 13 105.529 0.01 . 1 . . . A 35 U C5 . 25164 1 525 . 1 1 35 35 U C5' C 13 64.355 0.01 . 2 . . . A 35 U C5' . 25164 1 526 . 1 1 35 35 U C6 C 13 140.886 0.01 . 1 . . . A 35 U C6 . 25164 1 527 . 1 1 35 35 U N3 N 15 158.708 0.1 . 1 . . . A 35 U N3 . 25164 1 528 . 1 1 36 36 G H1 H 1 11.251 0.2 . 1 . . . A 36 G H1 . 25164 1 529 . 1 1 36 36 G H1' H 1 5.572 0.2 . 1 . . . A 36 G H1' . 25164 1 530 . 1 1 36 36 G H2' H 1 4.259 0.2 . 1 . . . A 36 G H2' . 25164 1 531 . 1 1 36 36 G H3' H 1 4.679 0.2 . 1 . . . A 36 G H3' . 25164 1 532 . 1 1 36 36 G H4' H 1 4.414 0.2 . 1 . . . A 36 G H4' . 25164 1 533 . 1 1 36 36 G H5' H 1 4.172 0.2 . 1 . . . A 36 G H5' . 25164 1 534 . 1 1 36 36 G H5'' H 1 4.547 0.02 . 1 . . . A 36 G H5'' . 25164 1 535 . 1 1 36 36 G H8 H 1 7.841 0.01 . 1 . . . A 36 G H8 . 25164 1 536 . 1 1 36 36 G C1' C 13 92.822 0.01 . 1 . . . A 36 G C1' . 25164 1 537 . 1 1 36 36 G C2' C 13 75.376 0.01 . 1 . . . A 36 G C2' . 25164 1 538 . 1 1 36 36 G C3' C 13 71.726 0.01 . 1 . . . A 36 G C3' . 25164 1 539 . 1 1 36 36 G C4' C 13 81.965 0.01 . 2 . . . A 36 G C4' . 25164 1 540 . 1 1 36 36 G C5' C 13 64.825 0.01 . 2 . . . A 36 G C5' . 25164 1 541 . 1 1 36 36 G C8 C 13 137.153 0.01 . 1 . . . A 36 G C8 . 25164 1 542 . 1 1 36 36 G N1 N 15 146.461 0.1 . 1 . . . A 36 G N1 . 25164 1 543 . 1 1 37 37 U H1' H 1 5.889 0.2 . 1 . . . A 37 U H1' . 25164 1 544 . 1 1 37 37 U H2' H 1 5.183 0.2 . 1 . . . A 37 U H2' . 25164 1 545 . 1 1 37 37 U H3 H 1 11.626 0.2 . 1 . . . A 37 U H3 . 25164 1 546 . 1 1 37 37 U H3' H 1 4.601 0.2 . 1 . . . A 37 U H3' . 25164 1 547 . 1 1 37 37 U H4' H 1 4.434 0.2 . 1 . . . A 37 U H4' . 25164 1 548 . 1 1 37 37 U H5 H 1 5.177 0.2 . 1 . . . A 37 U H5 . 25164 1 549 . 1 1 37 37 U H6 H 1 7.577 0.01 . 1 . . . A 37 U H6 . 25164 1 550 . 1 1 37 37 U C1' C 13 94.271 0.01 . 1 . . . A 37 U C1' . 25164 1 551 . 1 1 37 37 U C2' C 13 74.645 0.02 . 1 . . . A 37 U C2' . 25164 1 552 . 1 1 37 37 U C3' C 13 71.721 0.01 . 1 . . . A 37 U C3' . 25164 1 553 . 1 1 37 37 U C4' C 13 81.752 0.01 . 1 . . . A 37 U C4' . 25164 1 554 . 1 1 37 37 U C5 C 13 103.396 0.01 . 1 . . . A 37 U C5 . 25164 1 555 . 1 1 37 37 U C6 C 13 141.510 0.01 . 1 . . . A 37 U C6 . 25164 1 556 . 1 1 37 37 U N3 N 15 159.405 0.1 . 1 . . . A 37 U N3 . 25164 1 557 . 1 1 38 38 G H1' H 1 5.445 0.2 . 1 . . . A 38 G H1' . 25164 1 558 . 1 1 38 38 G H2' H 1 3.641 0.2 . 1 . . . A 38 G H2' . 25164 1 559 . 1 1 38 38 G H3' H 1 4.708 0.2 . 1 . . . A 38 G H3' . 25164 1 560 . 1 1 38 38 G H4' H 1 4.204 0.2 . 1 . . . A 38 G H4' . 25164 1 561 . 1 1 38 38 G H5' H 1 4.036 0.2 . 1 . . . A 38 G H5' . 25164 1 562 . 1 1 38 38 G H5'' H 1 4.262 0.2 . 1 . . . A 38 G H5'' . 25164 1 563 . 1 1 38 38 G H8 H 1 8.188 0.01 . 1 . . . A 38 G H8 . 25164 1 564 . 1 1 38 38 G C1' C 13 93.846 0.01 . 1 . . . A 38 G C1' . 25164 1 565 . 1 1 38 38 G C2' C 13 76.785 0.01 . 1 . . . A 38 G C2' . 25164 1 566 . 1 1 38 38 G C3' C 13 72.124 0.01 . 1 . . . A 38 G C3' . 25164 1 567 . 1 1 38 38 G C4' C 13 83.153 0.01 . 2 . . . A 38 G C4' . 25164 1 568 . 1 1 38 38 G C5' C 13 63.823 0.01 . 2 . . . A 38 G C5' . 25164 1 569 . 1 1 38 38 G C8 C 13 141.082 0.01 . 1 . . . A 38 G C8 . 25164 1 570 . 1 1 39 39 A H1' H 1 6.220 0.2 . 1 . . . A 39 A H1' . 25164 1 571 . 1 1 39 39 A H2 H 1 9.070 0.2 . 1 . . . A 39 A H2 . 25164 1 572 . 1 1 39 39 A H2' H 1 4.794 0.2 . 1 . . . A 39 A H2' . 25164 1 573 . 1 1 39 39 A H3' H 1 5.331 0.2 . 1 . . . A 39 A H3' . 25164 1 574 . 1 1 39 39 A H4' H 1 4.181 0.2 . 1 . . . A 39 A H4' . 25164 1 575 . 1 1 39 39 A H8 H 1 8.511 0.2 . 1 . . . A 39 A H8 . 25164 1 576 . 1 1 39 39 A H61 H 1 6.101 0.01 . 1 . . . A 39 A H61 . 25164 1 577 . 1 1 39 39 A C1' C 13 91.937 0.01 . 1 . . . A 39 A C1' . 25164 1 578 . 1 1 39 39 A C2 C 13 157.797 0.01 . 1 . . . A 39 A C2 . 25164 1 579 . 1 1 39 39 A C2' C 13 78.152 0.01 . 1 . . . A 39 A C2' . 25164 1 580 . 1 1 39 39 A C3' C 13 70.371 0.01 . 1 . . . A 39 A C3' . 25164 1 581 . 1 1 39 39 A C4' C 13 82.224 0.02 . 1 . . . A 39 A C4' . 25164 1 582 . 1 1 39 39 A C8 C 13 142.634 0.01 . 1 . . . A 39 A C8 . 25164 1 583 . 1 1 39 39 A N6 N 15 72.580 0.1 . 1 . . . A 39 A N6 . 25164 1 584 . 1 1 40 40 U H1' H 1 5.556 0.2 . 1 . . . A 40 U H1' . 25164 1 585 . 1 1 40 40 U H2' H 1 4.803 0.2 . 1 . . . A 40 U H2' . 25164 1 586 . 1 1 40 40 U H3 H 1 11.410 0.2 . 1 . . . A 40 U H3 . 25164 1 587 . 1 1 40 40 U H3' H 1 4.703 0.2 . 1 . . . A 40 U H3' . 25164 1 588 . 1 1 40 40 U H4' H 1 4.507 0.2 . 1 . . . A 40 U H4' . 25164 1 589 . 1 1 40 40 U H5 H 1 6.124 0.2 . 1 . . . A 40 U H5 . 25164 1 590 . 1 1 40 40 U H5' H 1 4.156 0.2 . 1 . . . A 40 U H5' . 25164 1 591 . 1 1 40 40 U H5'' H 1 4.628 0.01 . 1 . . . A 40 U H5'' . 25164 1 592 . 1 1 40 40 U H6 H 1 8.522 0.01 . 1 . . . A 40 U H6 . 25164 1 593 . 1 1 40 40 U C1' C 13 93.678 0.02 . 1 . . . A 40 U C1' . 25164 1 594 . 1 1 40 40 U C2' C 13 76.028 0.01 . 1 . . . A 40 U C2' . 25164 1 595 . 1 1 40 40 U C3' C 13 72.511 0.01 . 1 . . . A 40 U C3' . 25164 1 596 . 1 1 40 40 U C4' C 13 82.730 0.01 . 1 . . . A 40 U C4' . 25164 1 597 . 1 1 40 40 U C5 C 13 104.945 0.01 . 2 . . . A 40 U C5 . 25164 1 598 . 1 1 40 40 U C5' C 13 64.721 0.01 . 2 . . . A 40 U C5' . 25164 1 599 . 1 1 40 40 U C6 C 13 145.154 0.01 . 1 . . . A 40 U C6 . 25164 1 600 . 1 1 40 40 U N3 N 15 159.721 0.1 . 1 . . . A 40 U N3 . 25164 1 601 . 1 1 41 41 U H1' H 1 5.635 0.2 . 1 . . . A 41 U H1' . 25164 1 602 . 1 1 41 41 U H2' H 1 4.702 0.2 . 1 . . . A 41 U H2' . 25164 1 603 . 1 1 41 41 U H3 H 1 10.303 0.2 . 1 . . . A 41 U H3 . 25164 1 604 . 1 1 41 41 U H3' H 1 4.360 0.2 . 1 . . . A 41 U H3' . 25164 1 605 . 1 1 41 41 U H4' H 1 4.651 0.2 . 1 . . . A 41 U H4' . 25164 1 606 . 1 1 41 41 U H5 H 1 6.037 0.2 . 1 . . . A 41 U H5 . 25164 1 607 . 1 1 41 41 U H5' H 1 4.408 0.2 . 1 . . . A 41 U H5' . 25164 1 608 . 1 1 41 41 U H5'' H 1 4.326 0.01 . 1 . . . A 41 U H5'' . 25164 1 609 . 1 1 41 41 U H6 H 1 7.922 0.01 . 1 . . . A 41 U H6 . 25164 1 610 . 1 1 41 41 U C1' C 13 94.654 0.02 . 1 . . . A 41 U C1' . 25164 1 611 . 1 1 41 41 U C2' C 13 75.623 0.01 . 1 . . . A 41 U C2' . 25164 1 612 . 1 1 41 41 U C3' C 13 74.260 0.01 . 1 . . . A 41 U C3' . 25164 1 613 . 1 1 41 41 U C4' C 13 82.893 0.01 . 1 . . . A 41 U C4' . 25164 1 614 . 1 1 41 41 U C5 C 13 104.166 0.01 . 2 . . . A 41 U C5 . 25164 1 615 . 1 1 41 41 U C5' C 13 68.608 0.01 . 2 . . . A 41 U C5' . 25164 1 616 . 1 1 41 41 U C6 C 13 143.985 0.01 . 1 . . . A 41 U C6 . 25164 1 617 . 1 1 41 41 U N3 N 15 156.720 0.1 . 1 . . . A 41 U N3 . 25164 1 618 . 1 1 42 42 G H1 H 1 12.621 0.2 . 1 . . . A 42 G H1 . 25164 1 619 . 1 1 42 42 G H1' H 1 5.985 0.2 . 1 . . . A 42 G H1' . 25164 1 620 . 1 1 42 42 G H2' H 1 4.804 0.2 . 1 . . . A 42 G H2' . 25164 1 621 . 1 1 42 42 G H3' H 1 4.678 0.2 . 1 . . . A 42 G H3' . 25164 1 622 . 1 1 42 42 G H4' H 1 4.574 0.2 . 1 . . . A 42 G H4' . 25164 1 623 . 1 1 42 42 G H5' H 1 4.574 0.2 . 1 . . . A 42 G H5' . 25164 1 624 . 1 1 42 42 G H5'' H 1 4.256 0.02 . 1 . . . A 42 G H5'' . 25164 1 625 . 1 1 42 42 G H8 H 1 7.930 0.01 . 1 . . . A 42 G H8 . 25164 1 626 . 1 1 42 42 G C1' C 13 92.086 0.01 . 1 . . . A 42 G C1' . 25164 1 627 . 1 1 42 42 G C2' C 13 76.158 0.01 . 1 . . . A 42 G C2' . 25164 1 628 . 1 1 42 42 G C3' C 13 73.482 0.01 . 1 . . . A 42 G C3' . 25164 1 629 . 1 1 42 42 G C4' C 13 82.016 0.01 . 2 . . . A 42 G C4' . 25164 1 630 . 1 1 42 42 G C5' C 13 65.841 0.01 . 2 . . . A 42 G C5' . 25164 1 631 . 1 1 42 42 G C8 C 13 136.804 0.01 . 1 . . . A 42 G C8 . 25164 1 632 . 1 1 42 42 G N1 N 15 147.586 0.1 . 1 . . . A 42 G N1 . 25164 1 633 . 1 1 43 43 G H1 H 1 13.123 0.2 . 1 . . . A 43 G H1 . 25164 1 634 . 1 1 43 43 G H1' H 1 5.870 0.2 . 1 . . . A 43 G H1' . 25164 1 635 . 1 1 43 43 G H2' H 1 4.582 0.2 . 1 . . . A 43 G H2' . 25164 1 636 . 1 1 43 43 G H3' H 1 4.397 0.2 . 1 . . . A 43 G H3' . 25164 1 637 . 1 1 43 43 G H4' H 1 4.603 0.2 . 1 . . . A 43 G H4' . 25164 1 638 . 1 1 43 43 G H5' H 1 4.453 0.2 . 1 . . . A 43 G H5' . 25164 1 639 . 1 1 43 43 G H5'' H 1 4.153 0.02 . 1 . . . A 43 G H5'' . 25164 1 640 . 1 1 43 43 G H8 H 1 7.339 0.01 . 1 . . . A 43 G H8 . 25164 1 641 . 1 1 43 43 G C1' C 13 93.680 0.01 . 1 . . . A 43 G C1' . 25164 1 642 . 1 1 43 43 G C2' C 13 75.239 0.01 . 1 . . . A 43 G C2' . 25164 1 643 . 1 1 43 43 G C3' C 13 73.875 0.01 . 1 . . . A 43 G C3' . 25164 1 644 . 1 1 43 43 G C4' C 13 82.615 0.01 . 2 . . . A 43 G C4' . 25164 1 645 . 1 1 43 43 G C5' C 13 67.280 0.01 . 2 . . . A 43 G C5' . 25164 1 646 . 1 1 43 43 G C8 C 13 136.805 0.01 . 1 . . . A 43 G C8 . 25164 1 647 . 1 1 43 43 G N1 N 15 148.561 0.1 . 1 . . . A 43 G N1 . 25164 1 648 . 1 1 44 44 U H1' H 1 5.656 0.2 . 1 . . . A 44 U H1' . 25164 1 649 . 1 1 44 44 U H2' H 1 4.400 0.2 . 1 . . . A 44 U H2' . 25164 1 650 . 1 1 44 44 U H3 H 1 14.464 0.2 . 1 . . . A 44 U H3 . 25164 1 651 . 1 1 44 44 U H3' H 1 4.569 0.2 . 1 . . . A 44 U H3' . 25164 1 652 . 1 1 44 44 U H5 H 1 5.125 0.2 . 1 . . . A 44 U H5 . 25164 1 653 . 1 1 44 44 U H6 H 1 7.962 0.01 . 1 . . . A 44 U H6 . 25164 1 654 . 1 1 44 44 U C1' C 13 93.765 0.01 . 1 . . . A 44 U C1' . 25164 1 655 . 1 1 44 44 U C2' C 13 75.424 0.02 . 1 . . . A 44 U C2' . 25164 1 656 . 1 1 44 44 U C3' C 13 71.718 0.01 . 1 . . . A 44 U C3' . 25164 1 657 . 1 1 44 44 U C5 C 13 102.251 0.01 . 1 . . . A 44 U C5 . 25164 1 658 . 1 1 44 44 U C6 C 13 142.435 0.01 . 1 . . . A 44 U C6 . 25164 1 659 . 1 1 44 44 U N3 N 15 163.049 0.1 . 1 . . . A 44 U N3 . 25164 1 660 . 1 1 45 45 C H1' H 1 5.615 0.2 . 1 . . . A 45 C H1' . 25164 1 661 . 1 1 45 45 C H2' H 1 4.431 0.2 . 1 . . . A 45 C H2' . 25164 1 662 . 1 1 45 45 C H3' H 1 4.438 0.2 . 1 . . . A 45 C H3' . 25164 1 663 . 1 1 45 45 C H5 H 1 5.485 0.2 . 1 . . . A 45 C H5 . 25164 1 664 . 1 1 45 45 C H6 H 1 7.631 0.2 . 1 . . . A 45 C H6 . 25164 1 665 . 1 1 45 45 C H41 H 1 6.929 0.01 . 1 . . . A 45 C H41 . 25164 1 666 . 1 1 45 45 C H42 H 1 8.507 0.01 . 1 . . . A 45 C H42 . 25164 1 667 . 1 1 45 45 C C1' C 13 93.761 0.01 . 1 . . . A 45 C C1' . 25164 1 668 . 1 1 45 45 C C2' C 13 74.826 0.02 . 1 . . . A 45 C C2' . 25164 1 669 . 1 1 45 45 C C3' C 13 72.225 0.02 . 1 . . . A 45 C C3' . 25164 1 670 . 1 1 45 45 C C5 C 13 98.150 0.01 . 1 . . . A 45 C C5 . 25164 1 671 . 1 1 45 45 C C6 C 13 140.501 0.01 . 1 . . . A 45 C C6 . 25164 1 672 . 1 1 45 45 C N4 N 15 98.662 0.1 . 1 . . . A 45 C N4 . 25164 1 673 . 1 1 46 46 C H1' H 1 5.448 0.2 . 1 . . . A 46 C H1' . 25164 1 674 . 1 1 46 46 C H2' H 1 4.428 0.2 . 1 . . . A 46 C H2' . 25164 1 675 . 1 1 46 46 C H5 H 1 5.689 0.2 . 1 . . . A 46 C H5 . 25164 1 676 . 1 1 46 46 C H6 H 1 7.910 0.2 . 1 . . . A 46 C H6 . 25164 1 677 . 1 1 46 46 C C1' C 13 94.077 0.01 . 1 . . . A 46 C C1' . 25164 1 678 . 1 1 46 46 C C2' C 13 75.466 0.01 . 1 . . . A 46 C C2' . 25164 1 679 . 1 1 46 46 C C5 C 13 97.576 0.01 . 1 . . . A 46 C C5 . 25164 1 680 . 1 1 46 46 C C6 C 13 141.652 0.01 . 1 . . . A 46 C C6 . 25164 1 681 . 1 1 47 47 G H1' H 1 5.736 0.2 . 1 . . . A 47 G H1' . 25164 1 682 . 1 1 47 47 G H2' H 1 4.045 0.2 . 1 . . . A 47 G H2' . 25164 1 683 . 1 1 47 47 G H3' H 1 4.241 0.2 . 1 . . . A 47 G H3' . 25164 1 684 . 1 1 47 47 G H4' H 1 4.197 0.2 . 1 . . . A 47 G H4' . 25164 1 685 . 1 1 47 47 G H5' H 1 4.045 0.2 . 1 . . . A 47 G H5' . 25164 1 686 . 1 1 47 47 G H5'' H 1 4.402 0.2 . 1 . . . A 47 G H5'' . 25164 1 687 . 1 1 47 47 G H8 H 1 7.624 0.01 . 1 . . . A 47 G H8 . 25164 1 688 . 1 1 47 47 G C1' C 13 91.706 0.01 . 1 . . . A 47 G C1' . 25164 1 689 . 1 1 47 47 G C2' C 13 77.572 0.01 . 1 . . . A 47 G C2' . 25164 1 690 . 1 1 47 47 G C3' C 13 70.188 0.01 . 1 . . . A 47 G C3' . 25164 1 691 . 1 1 47 47 G C4' C 13 83.959 0.01 . 2 . . . A 47 G C4' . 25164 1 692 . 1 1 47 47 G C5' C 13 65.517 0.01 . 2 . . . A 47 G C5' . 25164 1 693 . 1 1 47 47 G C8 C 13 137.589 0.01 . 1 . . . A 47 G C8 . 25164 1 stop_ save_