data_25671 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 25671 _Entry.Title ; 1H Chemical Shift Assignments of the HIV ISS element ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2015-06-23 _Entry.Accession_date 2015-06-23 _Entry.Last_release_date 2015-11-30 _Entry.Original_release_date 2015-11-30 _Entry.Origination author _Entry.NMR_STAR_version 3.1.2.6 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Blanton Tolbert . S. . . 25671 2 Niyati Jain . . . . 25671 3 Christopher Morgan . E. . . 25671 4 Brittany Rife . D. . . 25671 5 Marco Salemi . . . . 25671 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 25671 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 'HIV intronic splicing silencer' . 25671 NMR . 25671 'RNA alternative splicing' . 25671 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 25671 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 172 25671 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2016-08-12 2015-06-23 update BMRB 'update entry citation' 25671 1 . . 2015-11-30 2015-06-23 original author 'original release' 25671 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 2N4L 'BMRB Entry Tracking System' 25671 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 25671 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 26607354 _Citation.Full_citation . _Citation.Title ; Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1 ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Biol. Chem.' _Citation.Journal_name_full . _Citation.Journal_volume 291 _Citation.Journal_issue 5 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 2331 _Citation.Page_last 2344 _Citation.Year 2016 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Niyati Jain . . . . 25671 1 2 Christopher Morgan . E. . . 25671 1 3 Brittany Rife . D. . . 25671 1 4 Marco Salemi . . . . 25671 1 5 Blanton Tolbert . S. . . 25671 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 25671 _Assembly.ID 1 _Assembly.Name 'HIV ISS element' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'RNA (53-MER)' 1 $RNA_(53-MER) A . yes native no no . . . 25671 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_RNA_(53-MER) _Entity.Sf_category entity _Entity.Sf_framecode RNA_(53-MER) _Entity.Entry_ID 25671 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name RNA_(53-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAAUAUUUUUGCUGUACUU UCUAUAGUGAAUAGAGUUAG GCAGGGAUAUUCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 53 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 17006.127 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 G . 25671 1 2 2 G . 25671 1 3 3 A . 25671 1 4 4 A . 25671 1 5 5 U . 25671 1 6 6 A . 25671 1 7 7 U . 25671 1 8 8 U . 25671 1 9 9 U . 25671 1 10 10 U . 25671 1 11 11 U . 25671 1 12 12 G . 25671 1 13 13 C . 25671 1 14 14 U . 25671 1 15 15 G . 25671 1 16 16 U . 25671 1 17 17 A . 25671 1 18 18 C . 25671 1 19 19 U . 25671 1 20 20 U . 25671 1 21 21 U . 25671 1 22 22 C . 25671 1 23 23 U . 25671 1 24 24 A . 25671 1 25 25 U . 25671 1 26 26 A . 25671 1 27 27 G . 25671 1 28 28 U . 25671 1 29 29 G . 25671 1 30 30 A . 25671 1 31 31 A . 25671 1 32 32 U . 25671 1 33 33 A . 25671 1 34 34 G . 25671 1 35 35 A . 25671 1 36 36 G . 25671 1 37 37 U . 25671 1 38 38 U . 25671 1 39 39 A . 25671 1 40 40 G . 25671 1 41 41 G . 25671 1 42 42 C . 25671 1 43 43 A . 25671 1 44 44 G . 25671 1 45 45 G . 25671 1 46 46 G . 25671 1 47 47 A . 25671 1 48 48 U . 25671 1 49 49 A . 25671 1 50 50 U . 25671 1 51 51 U . 25671 1 52 52 C . 25671 1 53 53 C . 25671 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 25671 1 . G 2 2 25671 1 . A 3 3 25671 1 . A 4 4 25671 1 . U 5 5 25671 1 . A 6 6 25671 1 . U 7 7 25671 1 . U 8 8 25671 1 . U 9 9 25671 1 . U 10 10 25671 1 . U 11 11 25671 1 . G 12 12 25671 1 . C 13 13 25671 1 . U 14 14 25671 1 . G 15 15 25671 1 . U 16 16 25671 1 . A 17 17 25671 1 . C 18 18 25671 1 . U 19 19 25671 1 . U 20 20 25671 1 . U 21 21 25671 1 . C 22 22 25671 1 . U 23 23 25671 1 . A 24 24 25671 1 . U 25 25 25671 1 . A 26 26 25671 1 . G 27 27 25671 1 . U 28 28 25671 1 . G 29 29 25671 1 . A 30 30 25671 1 . A 31 31 25671 1 . U 32 32 25671 1 . A 33 33 25671 1 . G 34 34 25671 1 . A 35 35 25671 1 . G 36 36 25671 1 . U 37 37 25671 1 . U 38 38 25671 1 . A 39 39 25671 1 . G 40 40 25671 1 . G 41 41 25671 1 . C 42 42 25671 1 . A 43 43 25671 1 . G 44 44 25671 1 . G 45 45 25671 1 . G 46 46 25671 1 . A 47 47 25671 1 . U 48 48 25671 1 . A 49 49 25671 1 . U 50 50 25671 1 . U 51 51 25671 1 . C 52 52 25671 1 . C 53 53 25671 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 25671 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $RNA_(53-MER) . 11676 organism . 'Human immunodeficiency virus 1' HIV . . Viruses . Lentivirus 'Human immunodeficiency virus 1' . . . . . . . . . . . . . 25671 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 25671 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $RNA_(53-MER) . 'In vitro transcription' 'T7 dependent In vitro Transcription' . . . . . . . . . . . . . . . 25671 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_ISS_1 _Sample.Sf_category sample _Sample.Sf_framecode ISS_1 _Sample.Entry_ID 25671 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'ISS (53-MER)' [U-2H] . . 1 $RNA_(53-MER) . . . 80 120 uM . . . . 25671 1 2 D2O 'natural abunance' . . . . . . 100 . . % . . . . 25671 1 stop_ save_ save_ISS_2 _Sample.Sf_category sample _Sample.Sf_framecode ISS_2 _Sample.Entry_ID 25671 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'ISS (53-MER)' [U-2H] . . 1 $RNA_(53-MER) . . . 80 120 uM . . . . 25671 2 2 D2O 'natural abunance' . . . . . . 100 . . % . . . . 25671 2 stop_ save_ save_ISS_3 _Sample.Sf_category sample _Sample.Sf_framecode ISS_3 _Sample.Entry_ID 25671 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'ISS (53-MER)' '[U-100% 13C]' . . 1 $RNA_(53-MER) . . . 80 120 uM . . . . 25671 3 2 D2O 'natural abunance' . . . . . . 100 . . % . . . . 25671 3 stop_ save_ ####################### # Sample conditions # ####################### save_ISS_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode ISS_conditions_1 _Sample_condition_list.Entry_ID 25671 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 25671 1 pH 6.5 . pH 25671 1 pressure 1 . atm 25671 1 temperature 298 . K 25671 1 stop_ save_ ############################ # Computer software used # ############################ save_NMRDraw _Software.Sf_category software _Software.Sf_framecode NMRDraw _Software.Entry_ID 25671 _Software.ID 1 _Software.Name NMRDraw _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 25671 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID processing 25671 1 stop_ save_ save_NMRPipe _Software.Sf_category software _Software.Sf_framecode NMRPipe _Software.Entry_ID 25671 _Software.ID 2 _Software.Name NMRPipe _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 25671 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID processing 25671 2 stop_ save_ save_X-PLOR_NIH _Software.Sf_category software _Software.Sf_framecode X-PLOR_NIH _Software.Entry_ID 25671 _Software.ID 3 _Software.Name X-PLOR_NIH _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 25671 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 25671 3 stop_ save_ save_TOPSPIN _Software.Sf_category software _Software.Sf_framecode TOPSPIN _Software.Entry_ID 25671 _Software.ID 4 _Software.Name TOPSPIN _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 25671 4 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID collection 25671 4 stop_ save_ save_AMBER _Software.Sf_category software _Software.Sf_framecode AMBER _Software.Entry_ID 25671 _Software.ID 5 _Software.Name AMBER _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 25671 5 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 25671 5 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 25671 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 900 save_ save_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_2 _NMR_spectrometer.Entry_ID 25671 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_spectrometer_3 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_3 _NMR_spectrometer.Entry_ID 25671 _NMR_spectrometer.ID 3 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 500 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 25671 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 900 . . . 25671 1 2 spectrometer_2 Bruker Avance . 800 . . . 25671 1 3 spectrometer_3 Bruker Avance . 500 . . . 25671 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 25671 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $ISS_1 isotropic . . 1 $ISS_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25671 1 2 '2D 1H-1H TOCSY' no . . . . . . . . . . 2 $ISS_2 isotropic . . 1 $ISS_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25671 1 3 '2D 1H-13C HMQC' no . . . . . . . . . . 3 $ISS_3 isotropic . . 1 $ISS_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25671 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 25671 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . 25671 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 25671 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $ISS_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 25671 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.7 . . . . . . A 1 G H1' . 25671 1 2 . 1 1 1 1 G H2' H 1 4.82 . . . . . . A 1 G H2' . 25671 1 3 . 1 1 1 1 G H8 H 1 8.07 . . . . . . A 1 G H8 . 25671 1 4 . 1 1 2 2 G H1' H 1 5.78 . . . . . . A 2 G H1' . 25671 1 5 . 1 1 2 2 G H2' H 1 4.54 . . . . . . A 2 G H2' . 25671 1 6 . 1 1 2 2 G H8 H 1 7.47 . . . . . . A 2 G H8 . 25671 1 7 . 1 1 3 3 A H1' H 1 5.8 . . . . . . A 3 A H1' . 25671 1 8 . 1 1 3 3 A H2 H 1 7.06 . . . . . . A 3 A H2 . 25671 1 9 . 1 1 3 3 A H2' H 1 4.5 . . . . . . A 3 A H2' . 25671 1 10 . 1 1 3 3 A H8 H 1 7.63 . . . . . . A 3 A H8 . 25671 1 11 . 1 1 4 4 A H1' H 1 5.76 . . . . . . A 4 A H1' . 25671 1 12 . 1 1 4 4 A H2 H 1 7.57 . . . . . . A 4 A H2 . 25671 1 13 . 1 1 4 4 A H2' H 1 4.28 . . . . . . A 4 A H2' . 25671 1 14 . 1 1 4 4 A H8 H 1 7.62 . . . . . . A 4 A H8 . 25671 1 15 . 1 1 5 5 U H1' H 1 5.3 . . . . . . A 5 U H1' . 25671 1 16 . 1 1 5 5 U H2' H 1 4.29 . . . . . . A 5 U H2' . 25671 1 17 . 1 1 5 5 U H6 H 1 7.44 . . . . . . A 5 U H6 . 25671 1 18 . 1 1 6 6 A H1' H 1 5.87 . . . . . . A 6 A H1' . 25671 1 19 . 1 1 6 6 A H2 H 1 6.96 . . . . . . A 6 A H2 . 25671 1 20 . 1 1 6 6 A H2' H 1 4.35 . . . . . . A 6 A H2' . 25671 1 21 . 1 1 6 6 A H8 H 1 7.99 . . . . . . A 6 A H8 . 25671 1 22 . 1 1 7 7 U H1' H 1 5.29 . . . . . . A 7 U H1' . 25671 1 23 . 1 1 7 7 U H2' H 1 4.36 . . . . . . A 7 U H2' . 25671 1 24 . 1 1 7 7 U H6 H 1 7.38 . . . . . . A 7 U H6 . 25671 1 25 . 1 1 8 8 U H1' H 1 5.34 . . . . . . A 8 U H1' . 25671 1 26 . 1 1 8 8 U H2' H 1 4.11 . . . . . . A 8 U H2' . 25671 1 27 . 1 1 8 8 U H6 H 1 7.8 . . . . . . A 8 U H6 . 25671 1 28 . 1 1 9 9 U H1' H 1 5.38 . . . . . . A 9 U H1' . 25671 1 29 . 1 1 9 9 U H2' H 1 4.09 . . . . . . A 9 U H2' . 25671 1 30 . 1 1 9 9 U H6 H 1 7.94 . . . . . . A 9 U H6 . 25671 1 31 . 1 1 10 10 U H1' H 1 5.43 . . . . . . A 10 U H1' . 25671 1 32 . 1 1 10 10 U H2' H 1 3.98 . . . . . . A 10 U H2' . 25671 1 33 . 1 1 10 10 U H6 H 1 7.9 . . . . . . A 10 U H6 . 25671 1 34 . 1 1 11 11 U H1' H 1 5.39 . . . . . . A 11 U H1' . 25671 1 35 . 1 1 11 11 U H2' H 1 4.44 . . . . . . A 11 U H2' . 25671 1 36 . 1 1 11 11 U H6 H 1 7.82 . . . . . . A 11 U H6 . 25671 1 37 . 1 1 12 12 G H1' H 1 5.62 . . . . . . A 12 G H1' . 25671 1 38 . 1 1 12 12 G H2' H 1 4.42 . . . . . . A 12 G H2' . 25671 1 39 . 1 1 12 12 G H8 H 1 7.6 . . . . . . A 12 G H8 . 25671 1 40 . 1 1 13 13 C H1' H 1 5.28 . . . . . . A 13 C H1' . 25671 1 41 . 1 1 13 13 C H2' H 1 4.41 . . . . . . A 13 C H2' . 25671 1 42 . 1 1 13 13 C H6 H 1 7.39 . . . . . . A 13 C H6 . 25671 1 43 . 1 1 14 14 U H1' H 1 5.36 . . . . . . A 14 U H1' . 25671 1 44 . 1 1 14 14 U H2' H 1 4.23 . . . . . . A 14 U H2' . 25671 1 45 . 1 1 14 14 U H6 H 1 7.41 . . . . . . A 14 U H6 . 25671 1 46 . 1 1 15 15 G H1' H 1 5.33 . . . . . . A 15 G H1' . 25671 1 47 . 1 1 15 15 G H2' H 1 4.31 . . . . . . A 15 G H2' . 25671 1 48 . 1 1 15 15 G H8 H 1 7.93 . . . . . . A 15 G H8 . 25671 1 49 . 1 1 16 16 U H1' H 1 5.34 . . . . . . A 16 U H1' . 25671 1 50 . 1 1 16 16 U H2' H 1 4.13 . . . . . . A 16 U H2' . 25671 1 51 . 1 1 16 16 U H6 H 1 7.62 . . . . . . A 16 U H6 . 25671 1 52 . 1 1 17 17 A H1' H 1 5.72 . . . . . . A 17 A H1' . 25671 1 53 . 1 1 17 17 A H2 H 1 7.85 . . . . . . A 17 A H2 . 25671 1 54 . 1 1 17 17 A H2' H 1 4.35 . . . . . . A 17 A H2' . 25671 1 55 . 1 1 17 17 A H8 H 1 7.95 . . . . . . A 17 A H8 . 25671 1 56 . 1 1 18 18 C H1' H 1 5.46 . . . . . . A 18 C H1' . 25671 1 57 . 1 1 18 18 C H2' H 1 4.07 . . . . . . A 18 C H2' . 25671 1 58 . 1 1 18 18 C H6 H 1 7.28 . . . . . . A 18 C H6 . 25671 1 59 . 1 1 19 19 U H1' H 1 5.78 . . . . . . A 19 U H1' . 25671 1 60 . 1 1 19 19 U H2' H 1 4.27 . . . . . . A 19 U H2' . 25671 1 61 . 1 1 19 19 U H6 H 1 7.69 . . . . . . A 19 U H6 . 25671 1 62 . 1 1 20 20 U H1' H 1 5.87 . . . . . . A 20 U H1' . 25671 1 63 . 1 1 20 20 U H2' H 1 4.45 . . . . . . A 20 U H2' . 25671 1 64 . 1 1 20 20 U H6 H 1 7.78 . . . . . . A 20 U H6 . 25671 1 65 . 1 1 21 21 U H1' H 1 5.7 . . . . . . A 21 U H1' . 25671 1 66 . 1 1 21 21 U H2' H 1 4.31 . . . . . . A 21 U H2' . 25671 1 67 . 1 1 21 21 U H6 H 1 7.85 . . . . . . A 21 U H6 . 25671 1 68 . 1 1 22 22 C H1' H 1 5.5 . . . . . . A 22 C H1' . 25671 1 69 . 1 1 22 22 C H2' H 1 4.44 . . . . . . A 22 C H2' . 25671 1 70 . 1 1 22 22 C H6 H 1 7.83 . . . . . . A 22 C H6 . 25671 1 71 . 1 1 23 23 U H1' H 1 5.37 . . . . . . A 23 U H1' . 25671 1 72 . 1 1 23 23 U H2' H 1 4.39 . . . . . . A 23 U H2' . 25671 1 73 . 1 1 23 23 U H6 H 1 7.78 . . . . . . A 23 U H6 . 25671 1 74 . 1 1 24 24 A H1' H 1 5.84 . . . . . . A 24 A H1' . 25671 1 75 . 1 1 24 24 A H2 H 1 7.39 . . . . . . A 24 A H2 . 25671 1 76 . 1 1 24 24 A H2' H 1 4.31 . . . . . . A 24 A H2' . 25671 1 77 . 1 1 24 24 A H8 H 1 8.04 . . . . . . A 24 A H8 . 25671 1 78 . 1 1 25 25 U H1' H 1 5.3 . . . . . . A 25 U H1' . 25671 1 79 . 1 1 25 25 U H2' H 1 4.18 . . . . . . A 25 U H2' . 25671 1 80 . 1 1 25 25 U H6 H 1 7.29 . . . . . . A 25 U H6 . 25671 1 81 . 1 1 26 26 A H1' H 1 5.57 . . . . . . A 26 A H1' . 25671 1 82 . 1 1 26 26 A H2 H 1 7.52 . . . . . . A 26 A H2 . 25671 1 83 . 1 1 26 26 A H2' H 1 4.25 . . . . . . A 26 A H2' . 25671 1 84 . 1 1 26 26 A H8 H 1 7.86 . . . . . . A 26 A H8 . 25671 1 85 . 1 1 27 27 G H1' H 1 5.54 . . . . . . A 27 G H1' . 25671 1 86 . 1 1 27 27 G H2' H 1 3.84 . . . . . . A 27 G H2' . 25671 1 87 . 1 1 27 27 G H8 H 1 7.53 . . . . . . A 27 G H8 . 25671 1 88 . 1 1 28 28 U H1' H 1 5.72 . . . . . . A 28 U H1' . 25671 1 89 . 1 1 28 28 U H2' H 1 4.11 . . . . . . A 28 U H2' . 25671 1 90 . 1 1 28 28 U H6 H 1 7.54 . . . . . . A 28 U H6 . 25671 1 91 . 1 1 29 29 G H1' H 1 5.39 . . . . . . A 29 G H1' . 25671 1 92 . 1 1 29 29 G H2' H 1 4.54 . . . . . . A 29 G H2' . 25671 1 93 . 1 1 29 29 G H8 H 1 7.61 . . . . . . A 29 G H8 . 25671 1 94 . 1 1 30 30 A H1' H 1 5.84 . . . . . . A 30 A H1' . 25671 1 95 . 1 1 30 30 A H2 H 1 7.86 . . . . . . A 30 A H2 . 25671 1 96 . 1 1 30 30 A H2' H 1 4.52 . . . . . . A 30 A H2' . 25671 1 97 . 1 1 30 30 A H8 H 1 8.07 . . . . . . A 30 A H8 . 25671 1 98 . 1 1 31 31 A H1' H 1 5.6 . . . . . . A 31 A H1' . 25671 1 99 . 1 1 31 31 A H2 H 1 7.5 . . . . . . A 31 A H2 . 25671 1 100 . 1 1 31 31 A H2' H 1 4.29 . . . . . . A 31 A H2' . 25671 1 101 . 1 1 31 31 A H8 H 1 8.09 . . . . . . A 31 A H8 . 25671 1 102 . 1 1 32 32 U H1' H 1 5.42 . . . . . . A 32 U H1' . 25671 1 103 . 1 1 32 32 U H2' H 1 4.47 . . . . . . A 32 U H2' . 25671 1 104 . 1 1 32 32 U H6 H 1 7.48 . . . . . . A 32 U H6 . 25671 1 105 . 1 1 33 33 A H1' H 1 5.83 . . . . . . A 33 A H1' . 25671 1 106 . 1 1 33 33 A H2 H 1 6.66 . . . . . . A 33 A H2 . 25671 1 107 . 1 1 33 33 A H2' H 1 4.48 . . . . . . A 33 A H2' . 25671 1 108 . 1 1 33 33 A H8 H 1 7.92 . . . . . . A 33 A H8 . 25671 1 109 . 1 1 34 34 G H1' H 1 5.36 . . . . . . A 34 G H1' . 25671 1 110 . 1 1 34 34 G H2' H 1 4.47 . . . . . . A 34 G H2' . 25671 1 111 . 1 1 34 34 G H8 H 1 6.96 . . . . . . A 34 G H8 . 25671 1 112 . 1 1 35 35 A H1' H 1 5.68 . . . . . . A 35 A H1' . 25671 1 113 . 1 1 35 35 A H2 H 1 7.47 . . . . . . A 35 A H2 . 25671 1 114 . 1 1 35 35 A H2' H 1 4.48 . . . . . . A 35 A H2' . 25671 1 115 . 1 1 35 35 A H8 H 1 7.45 . . . . . . A 35 A H8 . 25671 1 116 . 1 1 36 36 G H1' H 1 5.36 . . . . . . A 36 G H1' . 25671 1 117 . 1 1 36 36 G H2' H 1 4.18 . . . . . . A 36 G H2' . 25671 1 118 . 1 1 36 36 G H8 H 1 7.08 . . . . . . A 36 G H8 . 25671 1 119 . 1 1 37 37 U H1' H 1 5.44 . . . . . . A 37 U H1' . 25671 1 120 . 1 1 37 37 U H2' H 1 4.31 . . . . . . A 37 U H2' . 25671 1 121 . 1 1 37 37 U H6 H 1 7.45 . . . . . . A 37 U H6 . 25671 1 122 . 1 1 38 38 U H1' H 1 5.27 . . . . . . A 38 U H1' . 25671 1 123 . 1 1 38 38 U H2' H 1 4.09 . . . . . . A 38 U H2' . 25671 1 124 . 1 1 38 38 U H6 H 1 7.65 . . . . . . A 38 U H6 . 25671 1 125 . 1 1 39 39 A H1' H 1 5.81 . . . . . . A 39 A H1' . 25671 1 126 . 1 1 39 39 A H2 H 1 7.88 . . . . . . A 39 A H2 . 25671 1 127 . 1 1 39 39 A H2' H 1 4.76 . . . . . . A 39 A H2' . 25671 1 128 . 1 1 39 39 A H8 H 1 7.75 . . . . . . A 39 A H8 . 25671 1 129 . 1 1 40 40 G H1' H 1 5.03 . . . . . . A 40 G H1' . 25671 1 130 . 1 1 40 40 G H2' H 1 4.44 . . . . . . A 40 G H2' . 25671 1 131 . 1 1 40 40 G H8 H 1 7.3 . . . . . . A 40 G H8 . 25671 1 132 . 1 1 41 41 G H1' H 1 5.56 . . . . . . A 41 G H1' . 25671 1 133 . 1 1 41 41 G H2' H 1 4.44 . . . . . . A 41 G H2' . 25671 1 134 . 1 1 41 41 G H8 H 1 7.02 . . . . . . A 41 G H8 . 25671 1 135 . 1 1 42 42 C H1' H 1 5.37 . . . . . . A 42 C H1' . 25671 1 136 . 1 1 42 42 C H2' H 1 4.37 . . . . . . A 42 C H2' . 25671 1 137 . 1 1 42 42 C H6 H 1 7.53 . . . . . . A 42 C H6 . 25671 1 138 . 1 1 43 43 A H1' H 1 5.86 . . . . . . A 43 A H1' . 25671 1 139 . 1 1 43 43 A H2 H 1 6.71 . . . . . . A 43 A H2 . 25671 1 140 . 1 1 43 43 A H2' H 1 4.47 . . . . . . A 43 A H2' . 25671 1 141 . 1 1 43 43 A H8 H 1 7.92 . . . . . . A 43 A H8 . 25671 1 142 . 1 1 44 44 G H1' H 1 5.59 . . . . . . A 44 G H1' . 25671 1 143 . 1 1 44 44 G H2' H 1 4.4 . . . . . . A 44 G H2' . 25671 1 144 . 1 1 44 44 G H8 H 1 6.94 . . . . . . A 44 G H8 . 25671 1 145 . 1 1 45 45 G H1' H 1 5.65 . . . . . . A 45 G H1' . 25671 1 146 . 1 1 45 45 G H2' H 1 4.47 . . . . . . A 45 G H2' . 25671 1 147 . 1 1 45 45 G H8 H 1 6.92 . . . . . . A 45 G H8 . 25671 1 148 . 1 1 46 46 G H1' H 1 5.63 . . . . . . A 46 G H1' . 25671 1 149 . 1 1 46 46 G H2' H 1 4.64 . . . . . . A 46 G H2' . 25671 1 150 . 1 1 46 46 G H8 H 1 6.9 . . . . . . A 46 G H8 . 25671 1 151 . 1 1 47 47 A H1' H 1 5.83 . . . . . . A 47 A H1' . 25671 1 152 . 1 1 47 47 A H2 H 1 7.71 . . . . . . A 47 A H2 . 25671 1 153 . 1 1 47 47 A H2' H 1 4.35 . . . . . . A 47 A H2' . 25671 1 154 . 1 1 47 47 A H8 H 1 7.68 . . . . . . A 47 A H8 . 25671 1 155 . 1 1 48 48 U H1' H 1 5.36 . . . . . . A 48 U H1' . 25671 1 156 . 1 1 48 48 U H2' H 1 4.32 . . . . . . A 48 U H2' . 25671 1 157 . 1 1 48 48 U H6 H 1 7.54 . . . . . . A 48 U H6 . 25671 1 158 . 1 1 49 49 A H1' H 1 5.89 . . . . . . A 49 A H1' . 25671 1 159 . 1 1 49 49 A H2 H 1 7 . . . . . . A 49 A H2 . 25671 1 160 . 1 1 49 49 A H2' H 1 4.34 . . . . . . A 49 A H2' . 25671 1 161 . 1 1 49 49 A H8 H 1 8.04 . . . . . . A 49 A H8 . 25671 1 162 . 1 1 50 50 U H1' H 1 5.35 . . . . . . A 50 U H1' . 25671 1 163 . 1 1 50 50 U H2' H 1 4.17 . . . . . . A 50 U H2' . 25671 1 164 . 1 1 50 50 U H6 H 1 7.58 . . . . . . A 50 U H6 . 25671 1 165 . 1 1 51 51 U H1' H 1 5.52 . . . . . . A 51 U H1' . 25671 1 166 . 1 1 51 51 U H2' H 1 4.31 . . . . . . A 51 U H2' . 25671 1 167 . 1 1 51 51 U H6 H 1 7.89 . . . . . . A 51 U H6 . 25671 1 168 . 1 1 52 52 C H1' H 1 5.41 . . . . . . A 52 C H1' . 25671 1 169 . 1 1 52 52 C H2' H 1 4.06 . . . . . . A 52 C H2' . 25671 1 170 . 1 1 52 52 C H6 H 1 7.77 . . . . . . A 52 C H6 . 25671 1 171 . 1 1 53 53 C H1' H 1 5.41 . . . . . . A 53 C H1' . 25671 1 172 . 1 1 53 53 C H6 H 1 7.53 . . . . . . A 53 C H6 . 25671 1 stop_ save_