BMRB 1H Chemical Shift Entries
listed by accession number in descending order

  

Number of entries returned: 8817

  Query grid description

Retrieve entries as a:

 
Compressed file
 

Query result listed by accession number in descending order :

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Protein
DNA
RNA
21047
AIP-IV peptide
48
0
0
0
X
 
 
21046
AIP-II peptide
43
0
0
0
X
 
 
21045
AIP-I
44
0
0
0
X
 
 
21042
tAIP-III_D2A
32
0
0
0
X
 
 
21041
tAIP-III
33
0
0
0
X
 
 
21040
AIP-III_L7A peptide
38
0
0
0
X
 
 
21039
AIP-III_F5A_peptide
35
0
0
0
X
 
 
21038
AIP-III_DL7 peptide
45
0
0
0
X
 
 
21037
AIP-III_DF5
40
0
0
0
X
 
 
21036
AIP-III_D4A peptide
41
0
0
0
X
 
 
21035
AIP-III
37
0
0
0
X
 
 
21033
Lewisx-FimH
28
20
0
0
X
 
 
21028
MDCSGCSRPG + Zn acidic
48
0
0
0
X
 
 
21027
MDCSGCSRPG + Zn basic
47
0
0
0
X
 
 
21026
MDCSGCSRPG + Zn basic
47
0
0
0
X
 
 
21025
MDCSGCSRPG + Zn acidic
48
0
0
0
X
 
 
21024
MDCSGCSRPG bound to Cu
48
0
0
0
X
 
 
21023
MDCSGCSRPG
48
0
0
0
X
 
 
21022
MDCSGCSRPG
48
0
0
0
X
 
 
21019
Chikungunya Virus Fusion Peptide
61
0
0
0
X
 
 
21018
Compstatin_10
90
0
0
0
X
 
 
21015
conotoxin pu14a
108
0
0
0
X
 
 
21014
conotoxin lt14a
69
0
0
0
X
 
 
21013
RI23
112
0
0
0
X
 
 
21010
extended upain
111
48
0
0
X
 
 
21009
upain-1
76
37
0
0
X
 
 
21008
TemporinL
82
0
0
0
X
 
 
21007
alpha-conotoxin ImI Cystathionine 1-3
64
0
0
0
X
 
 
21006
alpha-conotoxin ImI Cystathionine 2-4
63
0
0
0
X
 
 
21002
Tryptophan Zipper analogue
81
0
0
0
X
 
 
21001
neurotensin
97
0
0
0
X
 
 
21000
MccJ25 RGD
98
0
0
0
X
 
 
20128
conotoxin qc16a
45
0
0
0
X
 
 
20127
nociceptin Agonist
68
0
0
0
X
 
 
20126
Alpha-conotoxin Vc1.2
84
41
17
0
X
 
 
20125
VK22 in DPC micelles
96
0
0
0
X
 
 
20124
[113-122]ApoJ
69
0
0
0
X
 
 
20123
NS4A(1-22)
100
58
0
0
X
 
 
20122
CCAP-vil
57
0
0
0
X
 
 
20121
tubulysin
52
0
0
0
X
 
 
20119
thromboxane A2 receptor
121
0
0
0
X
 
 
20118
C-terminal domain of the Gq protein alpha subunit in the presence of thromboxane A2 receptor
70
0
0
0
X
 
 
20117
Substance P in DMPC/CHAPS/GM1 bicelles
82
0
0
0
X
 
 
20116
Substance P in DMPC/CHAPS bicelles
82
0
0
0
X
 
 
20115
Substance P
82
0
0
0
X
 
 
20114
alpha-conotoxin FI
81
0
0
0
X
 
 
20113
Temporin-SHf
55
29
0
0
X
 
 
20112
Gaq-ct only
82
0
0
0
X
 
 
20111
SecA fragment
106
0
0
0
X
 
 
20110
VPgpU
140
0
1
0
X
 
 
20109
15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide)
78
0
0
0
X
 
 
20108
SecA fragment
114
0
0
0
X
 
 
20107
conotoxin ImI analogue
62
0
0
0
X
 
 
20105
BI
96
0
0
0
X
 
 
20104
xt-7
84
0
0
0
X
 
 
20103
[Lysine4]XT-7
96
0
0
0
X
 
 
20102
t11
109
0
0
0
X
 
 
20101
Substance P
70
0
0
0
X
 
 
20098
Pis-1 [PG]
126
0
0
0
X
 
 
20095
cis Pis-1[NkG]
127
0
0
0
X
 
 
20094
trans Pis-1[NkG]
127
0
0
0
X
 
 
20093
REV analogue
120
0
0
0
X
 
 
20092
csp
81
0
0
0
X
 
 
20091
rsv analogue
76
0
0
0
X
 
 
20090
KAAAD
23
0
0
0
X
 
 
20089
nociceptin analogue
121
0
0
0
X
 
 
20088
nociceptin analogue
121
0
0
0
X
 
 
20087
nociceptin analogue
121
0
0
0
X
 
 
20086
nociceptin Antagonist
80
0
0
0
X
 
 
20085
SFT-L1
60
0
0
0
X
 
 
20084
Dirhodium complex
80
44
0
0
X
 
 
20082
Apelin-17
138
64
13
0
X
 
 
20081
complex BK-PGG
57
0
0
0
X
 
 
20080
hCGA(G364S)
120
0
0
0
X
 
 
20079
rhodopsin-jue11-complex
60
0
0
0
X
 
 
20078
HEDISTIN
124
0
0
0
X
 
 
20076
TC6b
122
0
0
0
X
 
 
20075
MeuTXKbeta1
145
0
0
0
X
 
 
20073
cyclo[Trp-D-Leu-1,5-sub-(1,2,3)-triazole-D-Ala-Aod]
15
0
0
0
X
 
 
20072
cyclo[Trp-Leu-1,5-sub-(1,2,3)-triazole-D-Ala-Aod]
30
0
0
0
X
 
 
20071
cyclo[Trp-Ile-1,4-sub-(1,2,3)-triazole-D-Ala-Aod]
15
0
0
0
X
 
 
20070
Cyclic Tetrapeptide 1
41
0
0
0
X
 
 
20069
Cyclic Tetrapeptide 1
44
0
0
0
X
 
 
20068
Cyclic Tetrapeptide 1
44
0
0
0
X
 
 
20067
Cyclic Tetrapeptide 1
42
0
0
0
X
 
 
20066
Cyclic Tetrapeptide 1
36
0
0
0
X
 
 
20065
Cyclic Tetrapeptide 1
35
0
0
0
X
 
 
20064
Cyclic Tetrapeptide 1
24
0
0
0
X
 
 
20063
Model Peptide
68
0
0
0
X
 
 
20062
Myelin Basic Protein
109
0
0
0
X
 
 
20061
GG8WF
47
0
0
0
X
 
 
20060
YI12FF
68
0
0
0
X
 
 
20059
YI12WY
72
0
0
0
X
 
 
20058
YI12WW
73
0
0
0
X
 
 
20057
YI12WF
69
0
0
0
X
 
 
20056
LSEAL-CaMLD complex
27
0
0
0
X
 
 
20055
KIA7H tetramer
103
22
0
0
X
 
 
20054
KIA7W tetramer
112
48
0
0
X
 
 
20053
Insulin A-chain variant peptide
101
46
0
0
X
 
 
20052
Human Insulin A-chain peptide
82
30
0
0
X
 
 
20051
Human Obestatin
117
0
0
0
X
 
 
20050
D-PAKKR monomer
39
0
0
0
X
 
 
20049
Mu-KIIIA[C1A,C9A]
88
15
12
0
X
 
 
20048
Mu-contoxin KIIIA
91
14
15
0
X
 
 
20047
fusionpeptide
67
0
0
0
X
 
 
20046
RAT IAPP-1-19
84
0
0
0
X
 
 
20045
HUMAN IAPP-1-19
82
0
0
0
X
 
 
20044
Interleukin-8 C-terminal domain
134
0
4
0
X
 
 
20043
Cyclic Pseudotetrapeptide
27
0
0
0
X
 
 
20042
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20041
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20040
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20039
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20038
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20037
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20036
Cyclic Pseudotetrapeptide
27
0
0
0
X
 
 
20034
4F
127
0
0
0
X
 
 
20033
dicarba-ImI
65
34
10
0
X
 
 
20032
GBAP
60
0
10
0
X
 
 
20031
Apelin 17
137
60
0
0
X
 
 
20030
Apelin 17
137
61
0
0
X
 
 
20029
Apelin 17
125
70
0
0
X
 
 
20028
Statherin
88
0
0
0
X
 
 
20027
brome mosaic virus protein 1a
86
57
17
0
X
 
 
20026
F protein
109
0
0
0
X
 
 
20023
SIIIA monomer
109
52
26
0
X
 
 
20022
metastin analog
55
0
0
0
X
 
 
20020
PND_LAI
99
0
0
0
X
 
 
20019
PND MN
86
0
0
0
X
 
 
20018
Temporin-SHc
82
52
0
0
X
 
 
20017
Temporin-SHb
80
51
0
0
X
 
 
20016
Temporin-SHa
81
48
0
0
X
 
 
20015
PND SF2
73
4
0
0
X
 
 
20014
CAPISTRUIN
96
0
0
0
X
 
 
20013
PFR peptide
76
0
0
0
X
 
 
20012
PFR peptide
76
0
0
0
X
 
 
20009
CLN025
62
0
0
0
X
 
 
20008
L7P Con-T
42
0
0
0
X
 
 
20007
Conopressin-T
42
0
0
0
X
 
 
20005
Leu-enkephalin
24
24
0
0
X
 
 
20004
Leu-enkephalin
24
24
0
0
X
 
 
20003
Leu-enkephalin
24
24
0
0
X
 
 
20002
RgIA
77
0
0
0
X
 
 
20001
odorranalectin
92
0
0
0
X
 
 
19737
C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)
899
472
194
0
X
 
 
19729
HEN EGG BETA-DEFENSIN GALLIN (CHICKEN OVO-DEFENSIN)
253
0
0
0
X
 
 
19725
Ig-alpha YE variant Ig-beta construct
188
0
95
0
X
 
 
19724
Ig-alpha Ig-beta construct
249
119
83
0
X
 
 
19723
Ig-alpha Ig-beta construct
187
236
95
0
X
 
 
19709
HR8998C
794
584
147
0
X
 
 
19703
Iron-sulfur cluster binding protein from Ehrlichia chaffeensis
465
393
98
0
X
 
 
19698
preQ1 Class II riboswitch from Streptococcus pneumoniae
345
245
20
0
 
 
X
19694
FHL2 LIM adaptor and its Interaction with Ski
535
303
101
0
X
 
 
19692
Divalent Cations at the Active Site of the Neurospora VS Ribozyme
232
173
91
0
 
 
X
19687
immune signalling subunit
695
408
144
0
X
 
 
19684
HR9129A
373
270
66
0
X
 
 
19682
Zinc finger-PHD-type 1 domain_number-1
530
392
95
0
X
 
 
19669
Ms-NbGRP2 monomer
103
190
103
0
X
 
 
19667
carboxyterminal domain of NusG
356
263
60
0
X
 
 
19662
I-V kissing-loop interaction of the Neurospora VS ribozyme
231
186
67
0
 
 
X
19660
pmf-g
302
171
56
0
X
 
 
19658
maximin-4
144
0
0
0
X
 
 
19656
CD79b cytosolic domain phosphorylated
47
138
47
0
X
 
 
19655
CD79b cytosolic domain phosphorylated
48
139
48
0
X
 
 
19653
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
633
420
99
0
X
X
 
19651
CD79b cytosolic domain denatured
48
139
48
0
X
 
 
19650
CD79b cytosolic domain
48
139
48
0
X
 
 
19649
CD79a cytosolic domain phosphorylated
60
173
60
0
X
 
 
19648
CD79a cytosolic domain phosphorylated
60
172
60
0
X
 
 
19645
CD79a cytosolic domain
60
173
60
0
X
 
 
19644
CD79a cytosolic domain
59
170
59
0
X
 
 
19643
5-Hydroxytryptamine Receptor 2a and 2c Variants with PSD-95 and SAP997
531
296
90
0
X
 
 
19642
RBM39_RRM1
523
385
95
0
X
 
 
19634
CR4/5 domain of medaka telomerase RNA
463
335
65
0
 
 
X
19632
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
446
241
73
0
X
 
 
19629
Cyanobacterial GAF domain
213
357
132
0
X
 
 
19627
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
665
380
113
0
X
 
 
19624
circular sortase A
772
0
159
0
X
 
 
19621
CNBHD
683
554
137
0
X
 
 
19617
Big domain from Leptospira interrogans
366
248
92
0
X
 
 
19616
Dimethylarginine Dimethylaminohydrolase
238
486
237
0
X
 
 
19615
PaDDAH_TM
239
481
235
0
X
 
 
19614
basic-helix-loop-helix region of the transcriptional repressor HES-1
828
604
142
0
X
 
 
19611
Enzymatic cyclisation of kalata B1 using sortase A
156
74
0
0
X
 
 
19607
C-terminal domain of SRA1p
645
536
130
0
X
 
 
19605
PASTA domain of PonA2
324
245
61
0
X
 
 
19604
complex of calmodulin with minimal binding domain from HIV-1 matrix protein
1059
632
197
0
X
 
 
19600
CEH37 Homeodomain
375
199
64
0
X
 
 
19599
hman EPRS R12 repeats
711
520
136
0
X
 
 
19598
WHEP repeats
1072
768
211
0
X
 
 
19596
pdx1c
272
261
74
0
X
 
 
19595
oxytocin
52
24
0
0
X
 
 
19594
G-quadruplex bound to the bisquinolinium compound Phen-DC3
194
0
0
0
 
X
 
19593
Truncated EGF-A
136
62
0
0
X
 
 
19587
alpha-conotoxin Vc1.1: [3,16]-trans dicarba Vc1.1
30
31
11
0
X
 
 
19586
Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495
829
397
145
0
X
 
 
19578
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-trans dicarba Vc1.1
30
31
11
0
X
 
 
19577
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-cis dicarba Vc1.1
30
31
13
0
X
 
 
19576
FAPP1 PH domain monomer
97
274
97
0
X
 
 
19573
XANTHOMONIN II
67
0
0
0
X
 
 
19560
Middle domain of Hsp90alpha
404
1181
404
0
X
 
 
19557
circular g-domain analog from the wheat metallothionein Ec-1
114
0
0
0
X
 
 
19556
C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1
67
25
14
0
X
 
 
19555
C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11
58
26
12
0
X
 
 
19542
Mambalgin-2
329
143
58
0
X
 
 
19540
MyT1 F4F5 - DNA complex
51
115
51
0
X
X
 
19533
NusE (S10) from Thermotoga maritima
418
316
68
0
X
 
 
19525
Solution structure of the Nt. GR-RBP1 RRM domain
479
362
93
0
X
 
 
19523
N-terminal domain of Bilbo1 from Trypanosoma brucei
493
409
107
0
X
 
 
19518
RLC/MyBS
1148
788
203
0
X
 
 
19515
MPER-PB7
193
145
31
0
X
 
 
19514
MPER-Du151
192
112
34
0
X
 
 
19513
MPER-Con089
189
112
32
0
X
 
 
19512
MPER-HxB2-AA
187
142
32
0
X
 
 
19511
homeodomain transcription factor Gbx1
425
248
75
0
X
X
 
19510
Z-subunit
510
381
103
0
X
 
 
19507
CFP10 Monomer
109
317
109
0
X
 
 
19503
WW Domain with Loop 1 Excised
211
0
0
0
X
 
 
19501
Novel 4/7-Conotoxin LvIA
73
40
0
0
X
 
 
19489
MSP-P56S DOMAIN/VAPB
522
230
118
0
X
 
 
19486
Hr7298f
291
212
51
0
X
 
 
19485
SVIP mutation
411
280
67
0
X
 
 
19482
Regulatory Domain of Tyrosine Hydroxylase
460
358
88
0
X
 
 
19478
TNRC6Bm1
73
139
73
0
X
 
 
19474
uninhibited ETV6 ETS domain
632
349
101
0
X
 
 
19473
Sp140 PHD finger cis conformer
318
159
53
0
X
 
 
19472
Sp140 PHD finger trans conformer
313
159
52
0
X
 
 
19471
WG12_LPS
61
0
0
0
X
 
 
19470
KR8_LPS
35
0
0
0
X
 
 
19469
WK10_LPS
55
0
0
0
X
 
 
19468
WR17_LPS
90
0
0
0
X
 
 
19459
Recombinant CR1 fragment, domains 1-2
623
518
121
0
X
 
 
19458
Recombinant CR1 fragment, domains 2-3
249
152
67
0
X
 
 
19453
SP17945A
600
325
108
0
X
 
 
19449
BolA-like hypothetical protein RP812
403
320
80
0
X
 
 
19448
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
196
0
0
0
 
X
 
19447
Ubiquitin Binding with SH3 domains
132
0
132
0
X
 
 
19446
SSB
810
701
178
0
X
 
 
19443
EC1
117
311
117
0
X
 
 
19442
E7 dimer
39
126
42
0
X
 
 
19441
spermine modified DNA duplex
141
0
0
14
 
X
 
19440
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
136
0
0
14
 
X
 
19437
mammalian tachykinin neuropeptide gamma
91
0
0
0
X
 
 
19436
murine norovirus NS1/2 D94E mutant
453
307
75
0
X
 
 
19435
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
196
0
0
0
 
X
 
19433
YP_002937094.1
581
339
112
0
X
 
 
19431
hypothetical protein
693
398
121
0
X
 
 
19427
BldD-CTD monomer
489
368
88
0
X
 
 
19425
mouse RyR2 domain A
185
541
185
0
X
 
 
19423
Vav1 SH2 domain complex
563
315
92
0
X
 
 
19416
Rrp7 C-terminal Domain
318
218
49
0
X
 
 
19413
KpDsbA
1016
596
185
0
X
 
 
19412
K11-linked Diubiquitin
138
0
138
0
X
 
 
19411
OmpX within the trimeric chaperone Skp
129
236
129
0
X
 
 
19410
tOmpA within the tirmeric chaperone Skp
167
424
167
0
X
 
 
19409
Trimeric Skp with bound tOmpA
147
0
147
0
X
 
 
19408
trimeric Skp with bound OmpX
149
283
149
0
X
 
 
19407
trimeric Skp
133
257
133
0
X
 
 
19406
K11-linked Diubiquitin
140
0
140
0
X
 
 
19404
OR33_cns
694
504
110
0
X
 
 
19403
Clip-segment of the von Willebrand domain 1 of Crossveinless 2
347
195
63
0
X
 
 
19402
antiparallel (2+2) G-quadruplex
229
0
0
0
 
X
 
19400
The structure of the Box CD enzyme reveals regulation of rRNA methylation
0
0
0
0
X
 
X
19399
EKLF(22-40)/Ubiquitin Complex
583
339
101
0
X
 
 
19398
Forkhead DNA binding domain of Brugia malayi DAF-16a
609
423
109
0
X
 
 
19396
Lasiocepsin
180
90
25
0
X
 
 
19395
human holo-PRL-3 in complex with vanadate
761
427
130
0
X
 
 
19392
CARMA1/Bcl10/MALT1 Signalosome: Nucleation Induced Filamentous Assembly
637
466
116
0
X
 
 
19391
MBD3
391
309
68
0
X
X
 
19387
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
240
0
0
23
 
X
 
19385
conotoxin muPIIIA-2
141
0
0
0
X
 
 
19384
conotoxin muPIIIA-1
127
0
0
0
X
 
 
19379
alpha7 nAChR transmembrane domain
534
473
128
0
X
 
 
19377
IL10 dimer
214
457
152
0
X
 
 
19368
Structure of Pex14 in complex with Pex5 LVxEF motif
409
212
62
0
X
 
 
19367
complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA
560
317
103
0
X
X
 
19366
region 2 of E. coli sigmaE
572
334
108
0
X
 
 
19365
Lipid Transfer Protein from Lentil Lens Culinaris
503
271
97
0
X
 
 
19363
STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains
617
425
105
0
X
 
 
19362
STIM1 CC1-CC2 homodimer
485
357
78
0
X
 
 
19358
Val66 BDNF Prodomain
85
263
85
0
X
 
 
19357
Met66 BDNF Prodomain
85
264
85
0
X
 
 
19351
acetylated aSyn A53T monomer
133
400
133
0
X
 
 
19350
acetylated aSyn monomer
133
398
133
0
X
 
 
19349
aSyn mouse_T53A&N87S monomer
122
382
122
0
X
 
 
19348
aSyn mouse_N87S monomer
128
389
128
0
X
 
 
19347
aSyn_mouse_T53A
126
389
126
0
X
 
 
19346
aSyn_mouse
128
388
128
0
X
 
 
19345
aSyn_A53T&S87N
123
386
123
0
X
 
 
19344
aSyn_S87N
128
397
128
0
X
 
 
19338
aSyn A53T monomer
126
385
126
0
X
 
 
19337
aSyn
128
395
128
0
X
 
 
19336
5P12-RANTES-E66S
63
172
66
0
X
 
 
19335
5P12-RANTES-E66S
63
184
68
0
X
 
 
19334
Temporin-1 Ta in lipopolysaccharide micelles
56
0
0
0
X
 
 
19333
HIV-1 Vif SOCS-box with Elongin BC
250
417
160
0
X
 
 
19332
p15(PAF)
225
422
107
0
X
 
 
19331
HR7992A
375
265
76
0
X
 
 
19330
DUSP16 Monomer
123
379
123
0
X
 
 
19329
HR8700A
359
268
68
0
X
 
 
19328
HR7375C
340
251
62
0
X
 
 
19327
yahO
431
318
75
0
X
 
 
19321
cerato populin
704
528
135
0
X
 
 
19319
RasGRP2 EF hands bound to calcium
326
303
77
0
X
 
 
19318
drSTIL
112
172
50
0
X
 
 
19317
DNA helicase RecQ
415
283
70
0
X
 
 
19315
HHARI Catalytic Domain
380
222
87
0
X
 
 
19314
HR9151A
601
453
98
0
X
 
 
19312
hr4784b
331
253
62
0
X
 
 
19311
Saccharomyces cerevisiae Est3 protein
218
568
151
0
X
 
 
19309
complex between the amyloid beta peptide (1-40) and the polyphenol epsilon-viniferin glucoside
220
0
0
0
X
 
 
19304
kalata B7
154
0
0
0
X
 
 
19303
(HhH)2 domain of human FAAP24
333
196
56
0
X
 
 
19302
ERCC4 domain of human FAAP24
707
542
131
0
X
 
 
19299
MLV CTD IN
396
334
74
0
X
 
 
19297
holo DC-SIGNR CRD
451
431
116
0
X
 
 
19296
Pin1 WW domain mutant 6-1g
231
0
0
0
X
 
 
19295
Pin1 WW domain variant 6-1
222
0
0
0
X
 
 
19292
Pin1 WW domain mutant 5-1g
221
0
0
0
X
 
 
19291
Pin1 WW domain mutant 5-1
212
0
0
0
X
 
 
19290
NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA
1155
864
182
11
X
 
X
19288
HR7784A
529
369
90
0
X
 
 
19287
NACI
300
184
58
0
X
 
 
19286
BeF3 Activated Sma0114
206
71
103
0
X
 
 
19285
Calcium Sensor
143
199
69
0
X
 
 
19281
d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid
260
0
0
0
 
X
 
19280
d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid
263
0
0
0
 
X
 
19279
d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid
245
0
0
0
 
X
 
19278
d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid
266
0
0
0
 
X
 
19277
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
240
0
0
0
 
X
 
19276
d[CGCGAAGCATTCGCG] hairpin
139
0
0
0
 
X
 
19272
YopH
271
760
271
0
X
 
 
19268
HuPRP
800
425
160
0
X
 
 
19266
SNARE
0
0
0
0
X
 
 
19264
W184AM185A mutant of the HIV-1 capsid protein
206
648
206
0
X
 
 
19263
MPERp
197
7
0
0
X
 
 
19262
MPERp
190
18
0
0
X
 
 
19261
HIV capsid dimer
178
563
178
0
X
 
 
19260
RNA_(48-MER)
339
247
32
0
 
 
X
19251
Nlh2
349
187
58
0
X
 
 
19250
LASSO PEPTIDE ASTEXIN3
131
0
0
0
X
 
 
19249
PAI subdomain of Sleeping Beauty transposase
274
0
54
0
X
 
 
19248
SRSF1 RRM2 in complex with the RNA 5'-UGAAGGAC-3'
558
271
89
0
X
 
X
19247
plastocyanin
101
188
97
0
X
 
 
19245
HisJ and Histidine
228
697
228
0
X
 
 
19244
Domain 2 from E. coli HisJ
94
290
94
0
X
 
 
19243
Domain 1 from E. coli HisJ
139
425
139
0
X
 
 
19242
apo-HisJ
229
697
229
0
X
 
 
19241
FKBP12
626
479
105
0
X
 
 
19240
FKBP12
627
479
105
0
X
 
 
19239
2c TCR
188
543
188
0
X
 
 
19236
plastocyanin
94
195
94
0
X
 
 
19235
Aha1 dimer from Colwellia psychrerythraea
774
603
136
0
X
 
 
19234
MSP1-E28K
538
287
104
0
X
 
 
19233
msp1
557
382
108
0
X
 
 
19231
PmrA
609
460
110
0
X
 
 
19230
Hdm2
531
147
121
0
X
 
 
19229
PHD Domain from Human SHPRH
409
285
68
0
X
 
 
19228
Pdx1
61
184
61
0
X
 
 
19227
Pdx1
50
161
50
0
X
 
 
19226
2'F-RNA/2'F-ANA chimeric duplex
100
0
0
0
 
 
 
19217
SmTSP2EC2
494
274
82
0
X
 
 
19216
sod2 TM IV
143
0
35
0
X
 
 
19215
gp41-M-MAT
223
152
64
0
X
 
 
19214
Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain
676
547
145
0
X
 
 
19213
TePixJ
803
645
171
0
X
 
 
19212
rhodostomin 48ARGDWN-67NPWNG mutant
369
0
70
0
X
 
 
19211
rhodostomin 48ARGDWN-67NGLYG mutant
364
0
71
0
X
 
 
19210
rhodostomin P48A/M52W/P53N mutant
349
0
68
0
X
 
 
19209
HDHD4
210
654
210
0
X
 
 
19208
Arginine kinase transition state analogue complex
321
963
320
0
X
 
 
19207
HDHD4
201
610
201
0
X
 
 
19204
BAF155 SWIRM domain
510
280
86
0
X
 
 
19203
RRM2 of Homo sapiens splicing factor, arginine/serine-rich 1
511
281
87
0
X
 
 
19201
TAX1BP1 UBZ1+2
424
295
72
0
X
 
 
19200
LDLa
211
111
42
0
X
 
 
19198
SP18156A
391
233
70
0
X
 
 
19197
C-terminal structure of (Y81F)-EhCaBP1
303
266
68
0
X
 
 
19196
(Y81F)-EhCaBP1
271
248
60
0
X
 
 
19195
alfa-actinin from parasite Entamoeba histolytica
743
537
136
0
X
 
 
19194
20S-11S proteasome-activator complex
109
247
109
0
X
 
 
19193
(Y81F)-EhCaBP1
273
248
60
0
X
 
 
19192
beta-Hairpin Peptidomimetic Antibiotics
103
28
0
0
X
 
 
19191
eIF4E
338
262
60
0
X
 
 
19190
LptD
95
31
0
0
X
 
 
19189
hL-FABP
264
364
125
0
X
 
 
19188
hL-FABP:OLA
251
373
126
0
X
 
 
19187
Methanothermobacter thermautotrophicus MCM C-terminus
539
405
83
0
X
 
 
19186
S72-S107 peptide of 18.5 kDa MBP
70
114
34
0
X
 
 
19185
PilA
304
221
58
0
X
 
 
19183
Trp-cage 16b P12W: a Hyperstable Miniprotein
113
0
0
0
X
 
 
19182
Aprataxin
150
334
150
0
X
 
 
19181
PorH
295
0
66
0
X
 
 
19180
Trp-cage Circular Permutant
112
0
0
0
X
 
 
19179
mol1
395
307
75
0
X
 
 
19178
MS1
388
300
85
0
X
 
 
19177
[Asp2,11]RTD-1
101
51
0
0
X
 
 
19176
[Asp11]RTD-1
101
51
0
0
X
 
 
19175
[Asp2]RTD-1
102
52
0
0
X
 
 
19174
Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 1
47
91
47
0
X
 
 
19173
PTPN11 C-SH2 bound
675
504
120
0
X
 
 
19172
PTPN11 C-SH2 free
687
507
120
0
X
 
 
19169
PG_2175
860
669
163
0
X
 
 
19168
C-terminal domain of translation initiation factor IF-3
589
433
95
0
X
 
 
19165
HdeA homodimer
405
358
91
0
X
 
 
19164
cerebral dopamine neurotrophic factor (CDNF)
968
709
149
0
X
 
 
19163
J-domain of human DnaJA1
372
277
63
0
X
 
 
19162
p7 channel of Hepatitis C virus, genotype 5a
111
224
58
0
X
 
 
19160
hL-FABP:GCA
424
360
128
0
X
 
 
19154
Sungsanpin
91
77
0
0
X
 
 
19152
holo YqcA
805
627
158
0
X
 
 
19151
apo YqcA
760
587
138
0
X
 
 
19150
NpF2164-GAF3
356
509
179
0
X
 
 
19149
actinobacterial transcription factor RbpA
250
189
45
0
X
 
 
19148
actinobacterial transcription factor RbpA
239
189
44
0
X
 
 
19147
APC/C_CDH1-EMI1: multimodal mechanism of E3 ligase shutdown
527
355
86
0
X
 
 
19141
Dynorphin A, L5S
47
0
0
0
X
 
 
19140
R6W-DynA
55
0
0
0
X
 
 
19138
ED Complex
203
329
101
0
X
 
 
19137
ERGi
175
280
88
0
X
 
 
19136
ERGu
164
250
84
0
X
 
 
19135
MAP2c
2005
1847
465
0
X
 
 
19133
ttLO959M
35
0
0
0
X
 
 
19132
ctLO959W
40
0
0
0
X
 
 
19131
tIn936M
45
13
0
0
X
 
 
19130
cIn936M
44
13
0
0
X
 
 
19129
tIn936W
35
7
0
0
X
 
 
19128
cIn936
37
6
0
0
X
 
 
19126
GlyR
565
283
155
0
X
 
 
19123
B2705-b2m-pGR complex
92
0
92
0
X
 
 
19122
B2705-b2m-pLMP2 complex
80
0
80
0
X
 
 
19121
B2705-b2m-TIS complex
79
0
79
0
X
 
 
19120
B2705-b2m-pVIPR complex
79
0
79
0
X
 
 
19119
B2709-b2m-pGR complex
91
0
92
0
X
 
 
19118
B2709-b2m-pLMP2 complex
80
0
80
0
X
 
 
19116
B2709-b2m-TIS complex
82
0
82
0
X
 
 
19113
B2709-b2m-pVIPR complex
93
262
93
0
X
 
 
19112
MS1
101
66
20
0
X
 
 
19111
USP25
787
603
162
0
X
 
 
19110
PI3-SH3
394
328
92
0
X
 
 
19109
EH domain of EHD3 in presence of Ca2+
639
462
101
0
X
 
 
19108
human restriction factor APOBEC3A
950
502
203
0
X
 
 
19101
Enterocin 7B
257
0
0
0
X
 
 
19099
human beta-2 microglobulin
292
308
76
0
X
 
 
19095
SsoSSB
693
505
133
0
X
 
 
19094
Enterocin 7A
266
0
0
0
X
 
 
19088
Rv2140c
155
308
155
0
X
 
 
19084
mengovirus
223
251
65
0
X
 
 
19083
SENP1
275
447
216
0
X
 
 
19082
thymidylate_synthase
322
774
230
0
X
 
 
19080
NS2B-NS3pro
597
568
195
0
X
 
 
19076
CcP
195
515
195
0
X
 
 
19075
CcP-PPIX
183
609
183
0
X
 
 
19074
DidoPHD/H3K4me3
333
266
66
0
X
 
 
19071
GLUCAGON AIB2,16 LYS13-GAMMAGLU-GAMMAGLU-C16 AMIDE
172
0
0
0
X
 
 
19070
GLUCAGON AIB2,16 LYS13-GAMMAGLU-GAMMAGLU-C16 AMIDE
195
0
0
0
X
 
 
19069
EFGP
1407
1036
245
0
X
 
 
19068
HR2876C
507
373
91
0
X
 
 
19067
Solution structure of latherin
1181
917
205
0
X
 
 
19066
Solution structure of the FimH adhesin carbohydrate-binding domain
872
694
171
0
X
 
 
19061
S100A15
386
305
76
0
X
 
 
19056
IsdB N1
620
419
132
0
X
 
 
19054
human apoptotic protein tBid
737
564
125
0
X
 
 
19053
FimA wt
454
0
0
0
X
 
 
19051
calcium_channel_beta_subunit
290
900
292
0
X
 
 
19049
Solution structure of chicken Engrailed 2 homeodomain
410
332
85
0
X
 
 
19048
BcII
1280
730
231
0
X
 
 
19047
BcII
1287
710
235
0
X
 
 
19046
Phosphatase domain of PTPN5
212
460
212
0
X
 
 
19045
BID-BAK complex
1131
556
176
0
X
 
 
19044
PMM/PGM_D4
517
409
90
0
X
 
 
19043
Protein A binding by an engineered Affibody molecule
717
507
135
0
X
 
 
19042
Frataxin like monomer
700
365
121
0
X
 
 
19040
2'-5' AG1 lariat forming ribozyme
430
347
12
0
 
 
X
19038
complex of cytochrome P450cam and its electron donor putidaredoxin
247
0
247
0
X
 
 
19037
h-prune C-terminal domain
199
247
86
0
X
 
 
19036
Calmodulin/a-syn peptide complex
341
308
157
0
X
 
 
19035
G-rich VEGF aptamer with LNA modifications
189
0
0
0
 
X
 
19034
third RNA Recognition Motif (RRM) of U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
607
367
102
0
X
 
 
19033
SH3 domain of human RAS GAP 1
368
214
69
0
X
 
 
19032
Huwentoxin-IV
161
0
0
0
X
 
 
19030
Huwentoxin-IV
167
0
0
0
X
 
 
19027
rubredoxin type protein from Mycobacterium ulcerans
262
206
51
0
X
 
 
19026
HWTX-IV
177
0
0
0
X
 
 
19023
RNA polymerase binding protein A (RbpA)
415
252
76
0
X
 
 
19018
E. coli ribosomela decoding site with apramycin
262
256
101
27
 
 
X
19017
Bulges in G-quadruplexes
183
0
0
0
 
X
 
19015
Galphai3 bound to GDP
301
925
301
0
X
 
 
19014
putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegans
639
478
108
0
X
 
 
19013
RRM domain of the hypothetical protein
694
532
131
0
X
 
 
19012
hypothetical protein BT_0846
579
329
103
0
X
 
 
19008
SinR_FL
496
489
115
0
X
 
 
19006
VanU
571
461
111
0
X
 
 
19005
(His)6CcPCN
261
789
261
0
X
 
 
19004
CcP(His)6CN
267
820
267
0
X
 
 
19003
Core Domain (10-76) of the Feline Calicivirus VPg protein
405
307
81
0
X
 
 
19002
Core Domain (11-85) of the Murine Norovirus VPg protein
455
330
75
0
X
 
 
19001
OspE
868
653
163
0
X
 
 
19000
VV2_0175
499
356
71
0
X
 
 
18995
Human S100B and Basic Fibroblast Growth Factor (FGF2) Interaction
81
250
81
0
X
 
 
18994
zNTD
768
538
138
0
X
 
 
18993
Alt_a_1
126
379
126
0
X
 
 
18990
protein
660
540
134
0
X
 
 
18989
CgR160
871
643
156
0
X
 
 
18988
apo_paHO
152
478
149
0
X
 
 
18987
SACOL0876
676
487
109
0
X
 
 
18986
C-terminus of the minichromosome maintenance protein MCM
531
391
82
0
X
 
 
18985
DNA_1
182
0
0
20
 
X
 
18984
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
182
0
0
20
 
X
 
18982
CIC_polypeptid
758
390
124
0
X
 
 
18981
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
185
0
0
21
 
X
 
18980
NC inhibitor 3 complex
367
154
61
0
X
 
 
18979
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
179
0
0
20
 
X
 
18978
Ph1500: a homohexameric protein centered on a 12-bladed beta-propeller
883
674
131
0
X
 
 
18976
Ca-containing EF-hand protein
879
663
159
0
X
 
 
18975
Unmodified Helix 69
160
128
0
0
 
 
X
18974
HELIX_69
155
46
0
0
 
 
X
18973
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
179
0
0
20
 
X
 
18971
WW3*-aENaC PY peptide complex
315
219
60
0
X
 
 
18970
peptide
94
44
0
0
X
 
 
18967
E6
465
337
80
0
X
 
 
18966
ComP
605
466
93
0
X
 
 
18964
Novel Alpha4/6-Conotoxin TxIC
69
0
0
0
X
 
 
18963
Dido_PHD
358
268
68
0
X
 
 
18959
Rsa1p238-259
160
90
26
0
X
 
 
18958
Integrin L Transmembrane Domain
324
170
54
0
X
 
 
18956
STRUCTURE OF NAB2P TANDEM ZINC FINGER 34
418
301
72
0
X
 
 
18955
STRUCTURE OF NAB2P TANDEM ZINC FINGER 12
444
313
74
0
X
 
 
18954
GUCT
546
307
101
0
X
 
 
18953
gammaM-crystallin
689
648
165
0
X
 
 
18952
Phospholamban
49
0
49
0
X
 
 
18950
3',5'-LINKED 2'-O-(2-METHOXYETHYL)-RNA DUPLEX
173
0
0
0
 
 
X
18949
GroES
45
0
43
0
X
 
 
18947
SpnDE1
326
237
65
0
X
 
 
18946
As1a
191
136
40
0
X
 
 
18945
k-Ssm1a
311
209
63
0
X
 
 
18944
Gbx1
430
245
74
0
X
 
 
18943
N-terminal domain of pneumococcal PhtD protein with bound Zn(II)
692
529
128
0
X
 
 
18942
alpha-1 integrin I-domain in complex with GLOGEN triple helical peptide
968
740
189
0
X
 
 
18941
LFA-1 I-Domain
305
447
175
0
X
 
 
18939
C-terminal AbrB
225
168
43
0
X
 
 
18938
BTD-2[3,4]
103
53
0
0
X
 
 
18937
[Aba3,5,7,12,14,16]BTD-2
122
54
0
0
X
 
 
18931
[Aba5,7,12,14]BTD-2
116
53
0
0
X
 
 
18926
MCh-1
144
0
0
0
X
 
 
18925
chain_A
255
0
0
0
X
 
 
18924
chain_A
297
0
0
0
X
 
 
18923
[L-HisB24] insulin analogue at pH 8.0
255
0
0
0
X
 
 
18921
[L-HisB24] insulin analogue at pH 1.9
292
0
0
0
X
 
 
18919
Full-length cytochrome b5 with heme B
589
157
101
0
X
 
 
18918
NTL9_V3AI4A
54
160
54
0
X
 
 
18917
tstm1395
346
262
67
0
X
 
 
18916
BRCT domain of yeast REV1
546
398
86
0
X
 
 
18914
[Aba3,7,12,16]BTD-2
116
52
0
0
X
 
 
18913
[Aba3,16]BTD-2
110
54
0
0
X
 
 
18912
ADAM17
302
8
63
0
X
 
 
18911
NMR structure of the catalytic domain from E. faecium L,D-transpeptidase acylated by ertapenem
743
555
130
0
X
 
 
18910
NMR solution structure of the AVR3a11 from Phytophthora Capsici
325
205
58
0
X
 
 
18909
hs00507
465
332
74
0
X
 
 
18908
Human programmed cell death 1 receptor
660
453
119
0
X
 
 
18907
Duplex DNA
225
0
0
0
 
X
 
18906
CHD4
476
306
74
0
X
 
 
18905
RRM2 domain of the protein RBM10 from homo sapiens
606
446
124
0
X
 
 
18904
two domain PPIase SlpA from Escherichia coli
842
466
151
0
X
 
 
18902
major G-quadruplex
202
0
0
0
 
X
 
18901
C-terminal domain of the protein HCFC1
616
464
111
0
X
 
 
18900
NMR structure of the catalytic domain from E. faecium L,D-transpeptidase
756
577
136
0
X
 
 
18899
Doc monomer
608
488
116
0
X
 
 
18898
LMO4-DEAF-1 tethered complex
522
354
103
0
X
 
 
18897
NMR structure of the glycosylated conotoxin CcTx from Conus consors
199
126
0
0
X
 
 
18896
BI-FUNCTIONAL LYSOZYME-PROTEASE INHIBITOR
251
199
57
0
X
 
 
18895
N-terminal MAP1B LC
647
489
124
0
X
 
 
18894
d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma
223
102
18
0
 
 
X
18893
d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1
306
78
13
0
 
 
X
18892
helix II template boundary element from Tetrahymena telomerase RNA
184
151
34
0
 
 
X
18891
Tetrahymena telomerase RNA stem IV terminal loop
181
141
19
0
 
 
X
18890
CD3g cytosolic domain
43
136
43
0
X
 
 
18889
CD3e
47
152
47
0
X
 
 
18888
EGFR transmembrane - juxtamembrane (TM-JM) segment
226
223
55
0
X
 
 
18887
hypothetical protein lmo0427
610
462
112
0
X
 
 
18885
Rpt6
112
299
112
0
X
 
 
18884
CD79b
48
145
48
0
X
 
 
18883
TICAM-1 TIR domain
1013
750
186
0
X
 
 
18882
TICAM-2 TIR domain
1003
696
169
0
X
 
 
18880
MlcB
441
322
85
0
X
 
 
18879
SP-B C-terminal (residues 59-80) peptide
131
0
24
0
X
 
 
18878
Solution structure of the Hs. PSIP1 PWWP domain
591
408
90
0
X
 
 
18875
[Aba5,14]BTD-2, cyclic peptide
106
54
0
0
X
 
 
18874
ING4 PHD mutant N214D
330
0
61
0
X
 
 
18873
Lewisx-sp8 acetate
31
22
0
0
 
 
 
18872
ID3 stem
73
59
0
0
 
 
X
18871
chaperone in type III secretion system
60
203
60
0
X
 
 
18870
dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)
511
399
104
0
X
 
 
18869
HR8910C
361
283
65
0
X
 
 
18867
CD79a
120
351
120
0
X
 
 
18865
OvDpl(1-30)
184
0
0
0
X
 
 
18864
CsPinA
574
332
90
0
X
 
 
18863
MS1
328
278
78
0
X
 
 
18862
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
111
0
0
0
 
X
 
18861
Antiamoebin I
109
64
14
0
X
 
 
18859
Biosynthetic engineered B28K-B29P human insulin monomer
267
0
0
0
X
 
 
18858
Biosynthetic engineered B28K-B29P human insulin monomer
287
0
0
0
X
 
 
18857
alpha-synuclein
279
270
134
0
X
 
 
18856
GtYybT PAS Homodimer
721
498
122
0
X
 
 
18852
HIV-1 Rev ARM peptide (residues T34-R50)
156
100
28
0
X
 
 
18851
HIV-1 Rev ARM single polypeptide chain
149
103
27
0
X
 
 
18850
Haloferax volcanii HVO_2177 protein
554
441
98
0
X
 
 
18849
BfmrC
564
420
96
0
X
 
 
18848
LTBP1-E3cb15
363
291
95
0
X
 
 
18847
stacked G-quadruplex formed by human TERRA sequence
232
0
0
0
 
 
X
18846
SUP-12
570
430
99
0
X
 
X
18845
SUP-12
570
431
99
0
X
 
 
18844
UBLCP1
463
258
77
0
X
 
 
18843
FUN-EGF3
705
512
136
0
X
 
 
18842
complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4
724
552
144
0
X
 
 
18841
Antitoxin PaaA2
430
311
70
0
X
 
 
18840
CPEB1-ZZ_G-P-504-566
394
283
76
0
X
 
 
18839
monomeric sugarcane canecystatin
590
419
116
0
X
 
 
18838
ID3 stem loop of domain 1 in the ai5gamma group II intron
158
132
0
0
 
 
X
18837
VHH 18
617
422
124
0
X
 
 
18835
dodecamer duplex
109
0
0
0
 
X
 
18834
PDZ
502
391
87
0
X
 
 
18833
PDZ
513
394
90
0
X
 
 
18832
SH3 domain of DOCK180
419
212
61
0
X
 
 
18831
U14Ub1
428
328
70
0
X
 
 
18830
ALPS-23 peptide in SDS micelles
121
0
0
0
X
 
 
18829
TIA-1 protein
97
199
97
0
X
 
 
18826
C-terminal CFTR peptide and extended PDZ2 domain from NHERF1
770
508
132
0
X
 
 
18825
C-terminal CFTR peptide and extended PDZ1 domain from NHERF1
682
481
116
0
X
 
 
18824
extended PDZ1 domain from NHERF1
679
479
119
0
X
 
 
18823
PpdD
635
460
124
0
X
 
 
18822
trans-membrane domain of the NS2A
133
26
26
0
X
 
 
18821
ApoAcpP
441
337
82
0
X
 
 
18820
ApoAcpP-1
373
186
73
0
X
 
 
18819
ApoAcpP-3
449
349
81
0
X
 
 
18818
human S100A14
458
417
102
0
X
 
 
18816
CR10
215
164
44
0
X
 
 
18815
his-eiav-ca
207
650
207
0
X
 
 
18813
human PHF1 in complex with H3K36me3
360
239
61
0
X
 
 
18812
DUF3349
471
376
96
0
X
 
 
18811
Spidroin
514
313
112
0
X
 
 
18808
Nterminal domain of splicing factor 1
384
468
209
0
X
 
 
18806
Miz58
579
429
98
0
X
 
 
18805
HR4490C
367
259
60
0
X
 
 
18804
ErbB1 (EGFR, HER1)
272
202
46
0
X
 
 
18803
MHV N-linker peptide
27
60
27
0
X
 
 
18802
SF1N
739
553
116
0
X
 
 
18797
OmpX in DPC micelles
128
383
128
0
X
 
 
18796
OmpX in phopspholipid nanodiscs
131
377
131
0
X
 
 
18795
Amylin monomer
112
0
35
0
X
 
 
18794
module 2 from the E1 domain of C. elegans APL-1
391
252
68
0
X
 
 
18793
BCL-xL in complex with PUMA BH3 peptide
355
541
173
0
X
 
 
18792
BCL-xL
227
536
171
0
X
 
 
18791
WzcCD
229
702
229
0
X
 
 
18789
Kunitz-type neurotoxin LmKKT-1a
306
158
58
0
X
 
 
18788
staphylococcal nuclease E43S mutant
784
567
138
0
X
 
 
18787
F15L_polypeptide
436
0
73
0
X
 
 
18786
Erbin PDZ S47
108
215
108
0
X
 
 
18785
Erbin PDZ WT
106
213
106
0
X
 
 
18784
ABU8-3
196
114
0
0
X
 
 
18783
ASTEROPSIN B FROM MARINE SPONGE ASTEROPUS
199
118
0
0
X
 
 
18781
DNA
88
0
0
0
 
X
 
18780
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
89
0
0
0
 
X
 
18779
FrpD_protein
217
687
217
0
X
 
 
18777
MS1
418
616
201
0
X
 
 
18776
Hordeum vulgare glycine rich- RNA binding protein 1
394
248
91
0
X
 
 
18775
omp synthase
213
657
213
0
X
 
 
18774
omp synthase
212
656
212
0
X
 
 
18773
SCIN-B
82
242
82
0
X
 
 
18772
SCIN-A
78
240
78
0
X
 
 
18771
TatA oligomer
76
31
45
0
X
 
 
18770
TatA T22P
267
144
48
0
X
 
 
18766
PI-AnmTX Ugr 9a-1
153
77
0
0
X
 
 
18765
RRM1 monomer
554
415
99
0
X
 
 
18764
Phf19 links methylated lysine 36 of histone H3 to regulation of Polycomb activity
360
198
59
0
X
 
 
18763
FGFR3tm
248
189
47
0
X
 
 
18762
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
154
0
0
0
 
X
 
18761
FE65 PTB2
604
513
131
0
X
 
 
18760
YLTA IkappaBalpha
188
201
188
0
X
 
 
18759
CPAP IkappaBalpha
141
113
141
0
X
 
 
18758
First Catalytic Cysteine Half-domain
641
469
110
0
X
 
 
18757
theta-defensin HTD-2 (retrocyclin 2)
101
49
10
0
X
 
 
18756
WT IkappaBalpha
139
163
139
0
X
 
 
18755
Mdm2 (6-125) with Pip-1
489
405
113
0
X
 
 
18754
apo-IscU
25
16
3
0
X
 
 
18753
biofilm matrix promoter AbbA from B. subtilis
361
274
68
0
X
 
 
18750
IscU
25
16
2
0
X
 
 
18749
Ligase 10C
276
227
61
0
X
 
 
18748
Grb2 C-terminal SH3 domain
50
158
50
0
X
 
 
18741
Fibroblast Growth Factor Recoptor
254
814
254
0
X
 
 
18740
KSR1 CC-SAM
136
280
136
0
X
 
 
18738
eIF4GI-HEAT1
210
591
210
0
X
 
 
18737
complex of ubiquitin and CD2-associated protein
133
0
133
0
X
 
 
18736
Conotoxin_TxIB
88
0
0
0
X
 
 
18735
HR3520O
501
358
86
0
X
 
 
18734
ZP_02034617.1
561
315
100
0
X
 
 
18733
NB7890A
593
336
115
0
X
 
 
18732
NP_390345.1
525
323
90
0
X
 
 
18730
West_nile_protease
189
557
187
0
X
 
 
18729
MS2
177
126
32
0
X
 
 
18728
UP1
1083
801
198
0
X
 
 
18726
AcSp1-RP
832
487
165
0
X
 
 
18725
Faap24
558
341
79
0
X
 
 
18724
G-quadruplex_DNA
183
0
0
0
 
X
 
18723
RTD-1
87
41
12
0
X
 
 
18722
BTD-2
98
54
16
0
X
 
 
18721
D5
186
557
186
0
X
 
 
18720
Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptide
18
524
123
0
X
 
 
18719
beta 2 integrin tail
44
0
44
0
X
 
 
18718
alpha 4 integrin tail
36
0
36
0
X
 
 
18717
Ska1-MTBD
1270
1072
236
0
X
 
 
18716
HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serine
749
434
131
0
X
 
 
18715
MA
742
434
131
0
X
 
 
18714
HR7907F
471
332
83
0
X
 
 
18713
sC4
683
487
116
0
X
 
 
18711
CH3CS
527
311
95
0
X
 
 
18710
recombinant brazzein
300
223
59
0
X
 
 
18709
HMG-box/p53
1046
749
159
0
X
 
 
18708
Structure of Co-substituted microcrystalline SOD using PCS and PRE restraints by solid-state NMR
136
245
136
0
X
 
 
18706
influenza A virus S31N mutant (19-49) in presence of drug M2WJ332
177
114
30
0
X
 
 
18705
Antimicrobial Peptide Human Defensin 5
151
96
27
0
X
 
 
18704
Siglec5 CRD
110
330
110
0
X
 
 
18703
2-mercaptophenol-alpha3C
430
293
64
0
X
 
 
18702
RNA BINDING PROTEIN Solution structure of the third KH domain of KSRP in complex with the G-rich target sequence.
431
235
0
0
X
 
X
18701
UNC-60B from Caenorhabditis elegans
835
646
144
0
X
 
 
18700
XIAP(RING)-binding domain of XAF1
334
237
57
0
X
 
 
18699
DIMERIC PIL-E G-QUADRUPLEX DNA
134
0
0
0
 
X
 
18698
HR8614A
629
466
113
0
X
 
 
18697
rmodN-ACSL complex
556
522
145
0
X
 
 
18696
rmodN
560
574
143
0
X
 
 
18695
KIX domain complex (3)
468
323
92
0
X
 
 
18694
KIX domain complex
555
437
108
0
X
 
 
18693
Exocrine gland-secreting peptide 4
551
410
100
0
X
 
 
18692
HP1264
437
301
71
0
X
 
 
18691
tpr1 domain
111
198
111
0
X
 
 
18690
MOMERIC PIL-E G-QUADRUPLEX DNA
188
0
0
0
 
X
 
18689
tpr2a
132
252
132
0
X
 
 
18688
gp78 RING bound to Ube2g2:G2BR
55
0
55
0
X
 
 
18687
E coli adenylate kinase
155
0
155
0
X
 
 
18686
E coli adenylate kinase: E170A
189
0
189
0
X
 
 
18684
Chimeric Peptide of HBD2 and HBD3
134
0
0
0
X
 
 
18683
E coli adenylate kinase: wild type
197
0
197
0
X
 
 
18682
LIP5-CHMP5
1147
651
228
0
X
 
 
18681
LIP5(MIT)2
956
522
185
0
X
 
 
18680
LmCsp
341
239
72
0
X
 
 
18679
LmCsp_dT7
335
232
73
0
X
 
 
18678
RRM1-RBM10
537
368
100
0
X
 
 
18677
RING domain in ubiquitin ligase gp78
298
232
70
0
X
 
 
18676
MMP23_pro-domain_polypeptide
144
161
67
0
X
 
 
18673
potential acylphosphatase from Giardia lamblia
494
409
99
0
X
 
 
18672
S4WYILD
578
418
105
0
X
 
 
18671
complex between the Sgt2 homodimerization domain and the Get5 UBL domain
766
522
136
0
X
 
 
18670
Sgt2 homodimerization domain
352
284
70
0
X
 
 
18669
Get5
438
270
78
0
X
 
 
18668
FeoA
69
223
69
0
X
 
 
18666
dUTPase homotrimer
119
345
119
0
X
 
 
18665
dUTPase homotrimer
120
347
120
0
X
 
 
18664
NSD3
481
331
91
0
X
 
 
18663
The third member of the eIF4E family represses gene expression via a novel mode of recognition of the methyl-7 guanosine cap mo
1083
620
207
0
X
 
 
18662
SH3_domain_of_GAS7
357
266
64
0
X
 
 
18661
CSGI
103
0
0
0
X
 
 
18659
peptide epsilon(103-120)
90
0
0
0
X
 
 
18658
peptide a2N(1-17) from Mus musculus V-ATPase
80
0
0
0
X
 
 
18657
nfeAFP11
395
292
67
0
X
 
 
18656
Internal Loop 5'GAGU/3'UGAG
0
0
0
0
 
 
 
18655
Transmembrane Arced Helix (ArcH)
223
0
8
0
X
 
 
18654
Single-chain Insulin
314
191
54
0
X
 
 
18653
Bacterial Intein-Like domain from Clostridium thermocellum
787
607
139
0
X
 
 
18650
RelA-TAD/CBP-TAZ1 complex
940
531
175
0
X
 
 
18649
APPTM dimer
178
144
30
0
X
 
 
18648
APPTM V44M dimer
180
144
30
0
X
 
 
18647
mStARD4L124D
506
619
200
0
X
 
 
18645
PawS Derived Peptide 7 (PDP-7)
80
41
0
0
X
 
 
18644
PawS Derived Peptide 5 (PDP-5)
118
45
0
0
X
 
 
18643
PawS Derived Peptide 4 (PDP-4)
58
21
0
0
X
 
 
18642
Protein
344
256
62
0
X
 
 
18641
PawS derived peptide 11 (PDP-11)
106
46
0
0
X
 
 
18640
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
18639
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
18638
11_mer_oligonucleotide-B
142
0
0
0
 
X
 
18637
MS1
953
706
156
0
X
 
 
18636
MS1
707
544
139
0
X
 
 
18634
human -defensins 1 and 6
246
183
47
0
X
 
 
18633
small molecule-influenza RNA complex
186
0
0
0
 
 
X
18632
MS1
903
663
150
0
X
 
 
18631
N-80 ALR reduced
79
231
77
0
X
 
 
18630
N-80 ALR
72
225
81
0
X
 
 
18629
H-RasT35S mutant protein in complex with Kobe2601
88
77
0
0
X
 
 
18628
MS1
782
586
145
0
X
 
 
18627
VILIP-3 monomer
940
599
174
0
X
 
 
18626
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
198
0
0
0
 
X
 
18625
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
200
0
0
0
 
X
 
18624
N-terminal domain of a plant Grx
625
483
111
0
X
 
 
18623
mutant (T170E) second CARD of human RIG-I
559
431
96
0
X
 
 
18622
second CARD of human RIG-I
555
448
96
0
X
 
 
18621
La-type RNA-binding domain
468
361
80
0
X
 
 
18620
RRM domain
466
349
88
0
X
 
 
18619
Menk in DMPC SUV
28
0
0
0
X
 
 
18618
BAD-1 repeat loop
134
76
24
0
X
 
 
18617
G8A mutant of the influenza hemagglutinin fusion peptide
51
23
21
0
X
 
 
18614
Myo10 anti-CC
283
155
51
0
X
 
 
18613
Eph receptor
784
449
163
0
X
 
 
18612
HisRS
872
503
147
0
X
 
 
18611
Ubiquitin
72
216
72
0
X
 
 
18610
Ubiquitin
115
287
115
0
X
 
 
18608
ASC PYD
88
266
89
0
X
 
 
18607
Avrpiz-t
419
302
85
0
X
 
 
18606
anti-CRISPR protein Acr30-35
437
239
75
0
X
 
 
18605
HR8682B
606
447
107
0
X
 
 
18604
Solution structure of CCP modules 10-11 of complement factor H
758
568
123
0
X
 
 
18602
soluble domain of MmpS4
363
296
74
0
X
 
 
18601
GGBP_unbound
281
542
281
0
X
 
 
18600
S67
219
166
36
0
X
 
 
18599
FH11-12
717
550
125
0
X
 
 
18598
LytTR domain
100
302
100
0
X
 
 
18596
Eosinophil Cationic Protein
795
410
149
0
X
 
 
18593
RNA Duplex Containing a 2'-O-Pivaloyloxymethyl Modification
178
0
0
0
 
 
X
18592
MRH domain
523
361
96
0
X
 
 
18591
ilvN
531
387
98
0
X
 
 
18589
Cbp2
477
395
89
0
X
 
 
18588
Tyr_tRNA_Synthase
299
900
299
0
X
 
 
18587
MHV nsp3a momoner
599
407
107
0
X
 
 
18586
MS1
414
316
77
0
X
 
 
18585
Griffithsin (GRFT)
107
244
107
0
X
 
 
18584
gp78CUE/K48-Ub2 complex
111
0
111
0
X
 
 
18583
gp78CUE/K48-Ub2 complex
111
0
111
0
X
 
 
18582
gp78CUE bound to ubiquitin
371
228
121
0
X
 
 
18581
gp78 CUE domain
306
231
53
0
X
 
 
18580
H6-vMycCterm
539
413
119
0
X
 
 
18579
Methylated Histone Complex
829
598
137
0
X
 
 
18578
Connexin45 Carboxyl Terminal Domain
625
505
123
0
X
 
 
18577
Connexin45 Carboxyl Terminal Domain
559
406
92
0
X
 
 
18576
Griffithsin (GRFT)
107
244
107
0
X
 
 
18575
variant XI LipA
1010
741
195
0
X
 
 
18574
wild-type Lipase A
1032
753
195
0
X
 
 
18573
Ca-bound Phl p 7
426
298
79
0
X
 
 
18572
hemi-Mg-bound Phl p 7
430
299
79
0
X
 
 
18571
apo-Phl p 7
424
296
79
0
X
 
 
18570
zinc finger AFV1p06 protein
356
271
59
0
X
 
 
18569
EVH1
669
371
137
0
X
 
 
18568
NS4B
237
132
0
0
X
 
 
18567
S114A mutant of UVI31+
107
314
107
0
X
 
 
18566
TL-domain
638
511
119
0
X
 
 
18565
MLD PMT
470
366
81
0
X
 
 
18563
HR8578K
508
393
92
0
X
 
 
18562
VvMARTX
339
323
73
0
X
 
 
18561
OR250
626
455
109
0
X
 
 
18560
hs356_22_132
592
424
113
0
X
 
 
18559
MLL5
410
298
74
0
X
 
 
18557
Ca2+-bound CaBP7 N-terminal doman
494
377
88
0
X
 
 
18556
complex between Ca-Calmodulin and skeletal muscle myosin light chain kinase
144
0
144
0
X
 
 
18555
PA1075
538
429
105
0
X
 
 
18553
ZirS C-terminal Domain
753
540
125
0
X
 
 
18552
TM4-Cx43CT monomer
630
413
132
0
X
 
 
18551
C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497)
410
307
79
0
X
 
 
18550
V210I
791
460
132
0
X
 
 
18549
Helix-35 Stem-loop from E. coli 23S rRNA
185
181
42
0
 
 
X
18548
Fam96a
830
595
136
0
X
 
 
18547
MiR12
1064
783
201
0
X
 
 
18546
tandem zinc finger domain of Stc1
565
385
105
0
X
 
 
18545
C85M_S100A1 dimer
516
385
94
0
X
 
 
18542
Cytosolic Tails of aXb2 Integrin
153
28
0
0
X
 
 
18541
midkine-b
501
331
115
0
X
 
 
18540
midkine-a
554
367
122
0
X
 
 
18539
protein_16
730
433
133
0
X
 
 
18538
GPVI peptide mimetic
119
57
0
0
X
 
 
18537
collagelin
83
41
0
0
X
 
 
18536
KB1[GHRW; 23-28]
138
0
0
0
X
 
 
18535
Ribonuclease III
433
355
84
0
X
 
 
18534
Ribonuclease III in complex with RNA (32-MER)
672
487
90
0
X
 
X
18533
mptpa
868
516
159
0
X
 
 
18532
RNA Aptamer for B. anthracis Ribosomal Protein S8
220
201
65
0
 
 
X
18531
GB3
322
185
54
0
X
 
 
18530
C7CCPs
752
569
132
0
X
 
 
18529
K-Ras-GDP
455
489
161
0
X
 
 
18528
alpha tubulin 404-451
261
0
0
0
X
 
 
18527
beta tubulin 394-445
306
0
0
0
X
 
 
18526
HR3504C
981
700
152
0
X
 
 
18524
DNA_OUH
325
135
0
0
 
X
 
18523
HSP12 SDS
609
425
111
0
X
 
 
18522
PICK1 PDZ domain fused to the C10 DAT ligand
504
382
106
0
X
 
 
18521
Vta1-Vps60 complex
1315
926
232
0
X
 
 
18520
S72-S107 peptide of 18.5kDa murine MBP
163
141
36
0
X
 
 
18519
Retro Trp-cage peptide
124
65
0
0
X
 
 
18518
LC3B OPTN-LIR Ptot complex structure
874
548
141
0
X
 
 
18517
EDK-delta-Bd37
1196
693
208
0
X
 
 
18515
RNA (37-MER)
277
0
0
0
 
 
X
18514
MSL2
291
207
50
0
X
 
 
18513
recombinant tamapin
181
0
0
0
X
 
 
18511
HR8578D
453
334
79
0
X
 
 
18510
m-conotoxin
74
39
0
0
X
 
 
18509
Cu(I),Zn(II) superoxide dismutase
136
245
136
0
X
 
 
18508
beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrin
596
395
106
0
X
 
 
18507
beta2 carbohydrate module of AMP-activated protein kinase
601
397
103
0
X
 
 
18506
Tg Micronemal Protein 5
138
0
0
0
X
 
 
18505
MHV N NTD
610
422
122
0
X
 
 
18504
pfsub2
500
471
118
0
X
 
 
18503
RNA (49-MER)
338
234
64
0
 
 
X
18502
Smurf2 WW3 domain in complex with a Smad7 derived peptide
256
0
0
0
X
 
 
18501
NEDD4L WW2 domain in complex with a Smad7 derived peptide
303
0
0
0
X
 
 
18500
Smurf1 WW2 domain in complex with a Smad7 derived peptide
249
0
0
0
X
 
 
18499
YAP WW1 in complex with a Smad7 derived peptide
241
0
0
0
X
 
 
18498
YAP WW2 in complex with a Smad7 derived peptide
249
0
0
0
X
 
 
18497
autoinhibitory domain of human AMP-activated protein kinase catalytic subunit
303
231
62
0
X
 
 
18496
YdbC:dT19G1 complex
575
330
70
0
X
X
 
18495
Th205-316 dimer
626
1
0
0
X
 
 
18494
TM0026 monomer
59
171
59
0
X
 
 
18493
DsbB C41S
67
552
125
0
X
 
 
18492
SANT2 domain of NCoR2
410
287
71
0
X
 
 
18491
Th255-316 dimer
362
0
0
0
X
 
 
18490
TDRD3 complex
290
176
53
0
X
 
 
18489
HR2876B
597
448
90
0
X
 
 
18488
Oxydizied Sulfiredoxin C106V
451
435
97
0
X
 
 
18487
YR313A
668
386
119
0
X
 
 
18486
Reduced Sulfiredoxin
479
356
108
0
X
 
 
18485
Tb 1-C-Grx1 monomer
662
496
103
0
X
 
 
18484
G5
545
309
101
0
X
 
 
18481
ASTEXIN1
141
0
0
0
X
 
 
18480
major ampullate spidroin 1 N-terminal domain
737
537
152
0
X
 
 
18479
HRas166
159
469
158
0
X
 
 
18478
P75/LEDGF PWWP Domain
420
329
81
0
X
 
 
18477
A.fAglB_S2
151
0
151
0
X
 
 
18475
P2_gpX
359
208
68
0
X
 
 
18474
pwwp domain of TFIIS2-1
495
295
107
0
X
 
 
18473
L-PGDS/U-46619 complex
675
432
143
0
X
 
 
18471
PWWP_domain
549
298
101
0
X
 
 
18469
YdbC
458
338
77
0
X
 
 
18468
PaT415
482
370
76
0
X
 
 
18467
FAS1-4_R555W
655
514
132
0
X
 
 
18466
Wild-type FAS1-4
662
498
129
0
X
 
 
18465
OR157
678
483
105
0
X
 
 
18464
NCX3
737
572
135
0
X
 
 
18463
Eurocin
192
91
6
0
X
 
 
18462
Kaiso
1176
607
164
0
X
X
 
18461
H-Ras-GppNHp
162
163
162
0
X
 
 
18459
N0 domain of Neisseria meningitidis Pilus assembly protein PilQ
711
518
133
0
X
 
 
18458
HIRAN domain
691
354
118
0
X
 
 
18455
REV1-CT
524
380
98
0
X
 
 
18454
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
18453
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
18452
Synthetic cyclic oligonucleotide
116
0
0
0
X
X
 
18449
SBM
205
101
34
0
X
 
 
18448
NIPP1 1-143
121
258
121
0
X
 
 
18447
yeast Tah1 in complex with the Hsp90 C-terminal tail
680
346
119
0
X
 
 
18446
Apoform of Hahellin
71
222
71
0
X
 
 
18445
yeast Tah1
644
327
0
0
X
 
 
18443
thioredoxin
712
547
121
0
X
 
 
18442
R. rickettsii cold shock-like protein
413
293
77
0
X
 
 
18441
harmonin
587
322
91
0
X
 
 
18440
Analog of the fragment 197-221 of 1- adrenoreceptor
139
63
0
0
X
 
 
18439
BRD4 second bromodomain with NF-kB-K310ac peptide
748
444
117
0
X
 
 
18438
HR7057A
515
372
88
0
X
 
 
18437
gpFI C-terminal domain
319
187
60
0
X
 
 
18435
C-terminal domain of Tetrahymena telomerase protein p65
666
532
121
0
X
 
 
18434
C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)
509
382
97
0
X
 
 
18433
mouse Rev1 CTD in complex with the RIR of Pol Kappa
796
460
132
0
X
 
 
18432
Rev1
701
520
119
0
X
 
 
18431
mouse Rev1 C-terminal domain
618
363
100
0
X
 
 
18430
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
149
0
0
0
 
X
 
18429
OR188
611
435
95
0
X
 
 
18428
PilQ
781
721
209
0
X
 
 
18427
2'F-ANA and ANA self-complementary duplex
72
0
0
0
 
X
 
18426
human prion protein
810
461
150
0
X
 
 
18425
S100A11 dimer
406
353
87
0
X
 
 
18424
holoprotein
333
0
135
0
X
 
 
18423
holoprotein
348
0
135
0
X
 
 
18422
holoprotein
409
348
134
0
X
 
 
18421
eiavCA monomer
188
588
185
0
X
 
 
18420
magainin
53
0
0
0
X
 
 
18419
B2 domain of Neisseria meningitidis Pilus assembly protein PilQ
689
529
124
0
X
 
 
18418
pleurocidin
120
0
0
0
X
 
 
18417
H6-hBASP1
969
798
240
0
X
 
 
18416
ubiquitin homology of mouse BAG-1
528
383
96
0
X
 
 
18415
human C-type lectin domain family 4 member D
923
673
169
0
X
 
 
18414
AdcR
195
475
139
0
X
 
 
18413
AdcR
176
434
131
0
X
 
 
18412
phosphoprotein enriched in astrocytes 15A
708
472
132
0
X
 
 
18411
putative protein disulfide isomerase
908
695
147
0
X
 
 
18410
third transmembrane domain from the human copper transport 1
121
0
0
0
X
 
 
18409
second transmembrane domain from human copper transport 1
172
0
0
0
X
 
 
18408
first transmembrane domain from human copper transport 1
131
0
0
0
X
 
 
18405
Sviceucin
97
58
0
0
X
 
 
18404
Target Recognition Domain of Zoocin A
631
501
141
0
X
 
 
18403
UIM-SH3 monomer
104
194
104
0
X
 
 
18400
CTD-StpA
270
182
43
0
X
 
 
18399
ubiqutin-like protein from Trypanosoma bucei
377
224
77
0
X
 
 
18398
WNK1 Autoinhibitory Domain
602
438
97
0
X
 
 
18397
GB1
66
186
61
0
X
 
 
18396
nanocrystalline DsbA
140
427
138
0
X
 
 
18395
DsbB
67
132
67
0
X
 
 
18394
uncharacterized thioredoxin-like protein BVU_1432
875
662
157
0
X
 
 
18393
dsRBD
405
309
67
0
X
 
 
18392
EIC dimer
266
810
266
0
X
 
 
18391
R3H domain from human Smubp-2 in complex with 2'-deoxyguanosine-5'-monophosphate
417
0
75
0
X
 
 
18390
Fr822A
414
321
78
0
X
 
 
18389
CtCBM11
848
619
173
0
X
 
 
18388
CtCBM11
941
690
176
0
X
 
 
18387
thiol:disulfide interchange protein
874
676
149
0
X
 
 
18386
HP1 CSDalpha(109-185)
72
0
70
0
X
 
 
18385
H3(1-59)
55
0
55
0
X
 
 
18381
IscU-HscA
71
219
71
0
X
 
 
18380
dvCcmE'
296
270
93
0
X
 
 
18379
IIA(chb)-HPr complex
854
689
181
0
X
 
 
18378
Liraglutide
162
0
0
0
X
 
 
18377
MTIP(61-204)
142
423
142
0
X
 
 
18376
MTIP(61-204)
137
422
137
0
X
 
 
18375
staphyloxanthin_protein
577
433
119
0
X
 
 
18374
AIRE-PHD2
327
192
62
0
X
 
 
18373
bLAC
229
444
229
0
X
 
 
18372
OR137
867
612
141
0
X
 
 
18371
EB1 C-terminal domain
67
177
67
0
X
 
 
18370
W123G
125
0
125
0
X
 
 
18369
W111G
122
0
122
0
X
 
 
18368
W108G
121
0
121
0
X
 
 
18367
W62G
116
0
116
0
X
 
 
18366
W28G
125
0
125
0
X
 
 
18365
WT-ALA
429
363
125
0
X
 
 
18364
GS13500A_assembly
658
392
130
0
X
 
 
18363
Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptide
144
48
22
0
X
 
 
18362
IscU(S107A)
92
263
90
0
X
 
 
18361
IscU(N90A)
87
258
87
0
X
 
 
18360
IscU(E111A)
80
243
80
0
X
 
 
18359
IscU(D39V)
102
306
102
0
X
 
 
18358
dimeric Acanthaporin
185
0
43
0
X
 
 
18357
Acanthaporin
247
0
0
0
X
 
 
18356
ADF like UNC-60A Protein
946
719
162
0
X
 
 
18355
Rv0603-SSD
389
308
76
0
X
 
 
18354
conotoxin_TIA
131
0
0
0
X
 
 
18353
Kelch domain of mouse Keap1
251
490
251
0
X
 
 
18352
HR8150A
433
308
70
0
X
 
 
18351
MS3
410
308
79
0
X
 
 
18350
cathelicidin-PY
148
0
0
0
X
 
 
18349
RF2209A
510
294
88
0
X
 
 
18348
EB1 CH domain
126
367
126
0
X
 
 
18347
micasin
201
0
0
0
X
 
 
18346
NP_390037.1 from Bacillus subtilis
776
432
141
0
X
 
 
18345
anti-fungal defensin DEF4 (MTR_8g070770)
238
22
48
0
X
 
 
18344
assembly
192
487
177
0
X
 
 
18342
Get5_UBL domain
479
383
82
0
X
 
 
18341
Sgt2_NT homodimer
439
329
82
0
X
 
 
18340
Bax+vMIA
106
38
11
0
X
 
 
18339
FTSA
324
1049
324
0
X
 
 
18338
PPc
529
368
102
0
X
 
 
18337
OR136
859
609
140
0
X
 
 
18336
RNA_(27-MER)
209
69
9
0
 
 
X
18335
gH625-644
87
0
0
0
X
 
 
18334
trypsin inhibitor BWI-2c
268
21
45
0
X
 
 
18333
phosphorylated CRKL
837
701
235
0
X
 
 
18332
Escherichia coli Porins
382
239
67
0
X
 
 
18331
MS1
453
338
83
0
X
 
 
18329
DBPA
746
633
156
0
X
 
 
18328
CHCHD7
377
273
74
0
X
 
 
18327
atypical SH3 domain of DOCK180
314
177
57
0
X
 
 
18326
Ni(II)-bound NmtR homedimer
81
69
81
0
X
 
 
18325
oxidized_Mrx1
462
368
88
0
X
 
 
18324
TAR RNA binding protein 2 (19-228)
192
589
192
0
X
 
 
18323
calcium-bound CaM C-terminal domain in a complex
224
261
68
0
X
 
 
18322
reduced_Mrx1
467
370
90
0
X
 
 
18321
CRKL
870
882
232
0
X
 
 
18320
PhoRadA intein
984
708
162
0
X
 
 
18319
Y4_TM1-TM2
669
479
120
0
X
 
 
18318
CHCH5
271
264
73
0
X
 
 
18317
sugarcane cystatin
590
419
116
0
X
 
 
18316
C-terminal domain of the MgtC protein
190
264
89
0
X
 
 
18315
FOXO3a
725
512
124
0
X
 
 
18314
FOXO3a
726
512
124
0
X
 
 
18313
A domain of talin
750
552
145
0
X
 
 
18312
PiCyp_A
755
665
171
0
X
 
 
18310
FliGn-FliFc
103
311
103
0
X
 
 
18309
FliGn homodimer
91
191
91
0
X
 
 
18307
A2POBEC2 1-224
198
387
198
0
X
 
 
18306
A2POBEC2 41-224
158
466
158
0
X
 
 
18303
PfPMT
1125
893
253
0
X
 
 
18302
calcium-bound CaM N-terminal domain in a complex
447
364
95
0
X
 
 
18301
MBD2
339
281
69
0
X
 
 
18300
Solution NMR structure of asteropusin A from marine sponge Asteropus sp.
202
118
0
0
X
 
 
18299
K60A mutant of Atox1
316
259
68
0
X
 
 
18298
NusG
989
549
147
0
X
 
 
18297
Uba3
485
367
82
0
X
 
 
18296
BRD1_PHD2_finger
441
289
77
0
X
 
 
18295
Granulocyte colony-stimulating factor A37G
155
471
153
0
X
 
 
18294
Granulocyte colony-stimulating factor A30G
159
475
155
0
X
 
 
18293
Granulocyte colony-stimulating factor A29G
157
476
156
0
X
 
 
18292
RBM39
622
476
120
0
X
 
 
18291
Granulocyte colony-stimulating factor
157
475
155
0
X
 
 
18290
SnR212
601
445
115
0
X
 
 
18289
antifreeze_peptide_4m
69
0
0
0
X
 
 
18288
Ninjurin1 monomer
228
233
73
0
X
 
 
18287
PAP248-286
196
0
0
0
X
 
 
18286
antifreeze_peptide_3
90
0
0
0
X
 
 
18284
antifreeze_peptide_1m
94
0
0
0
X
 
 
18283
YmgD dimer
476
342
96
0
X
 
 
18282
M-PMV MYRISTOYLATED MATRIX PROTEIN
441
419
103
0
X
 
 
18281
Strawberry
808
609
144
0
X
 
 
18280
CD81 LEL
85
257
85
0
X
 
 
18279
human CEB25 minisatellite G-quadruplex
233
56
0
25
 
X
 
18278
FKBP12 from Aedes aegypti
585
423
104
0
X
 
 
18277
KmAtg10
909
688
162
0
X
 
 
18276
PrgI needle
74
380
85
0
X
 
 
18269
N-terminal domain of human CDNF
574
360
98
0
X
 
 
18268
EF-hand_domain_of_polycystin-2
159
145
72
0
X
 
 
18267
DNA Polymerase beta uncomplexed
263
521
264
0
X
 
 
18266
Dengue Virus NS2B/NS3 in complex with Aprotinin
172
530
172
0
X
 
 
18263
RPA2022
554
436
102
0
X
 
 
18262
Major_ampullate_spidroin_1
712
418
142
0
X
 
 
18261
A72R
719
542
142
0
X
 
 
18260
R17
638
483
122
0
X
 
 
18257
DmsD
168
534
167
0
X
 
 
18256
monomeric phospholamban (C36A, C41F, C46A)
101
152
50
0
X
 
 
18255
MbtH-like protein
435
339
84
0
X
 
 
18254
apo-azurin
107
0
107
0
X
 
 
18253
P1 endolysin Lyz
675
608
176
0
X
 
 
18250
Bcl-XL
948
733
183
0
X
 
 
18249
CcmG
807
639
156
0
X
 
 
18248
ThrRS-dTP(2-60)
231
49
51
0
X
 
 
18246
porcine pepsin
303
928
303
0
X
 
 
18245
porcine pepsin
291
613
291
0
X
 
 
18244
complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15
639
487
102
0
X
 
 
18243
alpha-synuclein fibrils
49
127
48
0
X
 
 
18242
PYNOD PYD
581
428
93
0
X
 
 
18240
Mutant of the sub-genomic promoter from Brome Mosaic Virus
100
0
0
14
 
 
X
18239
RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP*AP*UP*CP*UP*UP*C)-3')
105
0
0
15
 
 
X
18238
APOPTOSIS ACTIVATING PHOTOSWITCHABLE BAK PEPTIDE BOUND to BCL-XL
943
636
183
0
X
 
 
18237
gp41-M-MAT
223
152
64
0
X
 
 
18235
N-dre2
713
466
127
0
X
 
 
18234
P1-CheY/P2 complex
108
0
108
0
X
 
 
18231
S100A1 homodimer
512
380
91
0
X
 
 
18230
S100A1 dimer
517
349
95
0
X
 
 
18229
complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2
926
690
173
0
X
 
 
18228
TpbA monomer
985
542
172
0
X
 
 
18227
MS1
338
271
70
0
X
 
 
18226
MS1
324
267
70
0
X
 
 
18225
MS1
342
281
70
0
X
 
 
18224
MS1
323
271
70
0
X
 
 
18223
TMEM14C
151
257
101
0
X
 
 
18222
TMEM141
281
197
103
0
X
 
 
18221
FAM14B
330
350
107
0
X
 
 
18220
TMEM14A
312
350
97
0
X
 
 
18219
TMEM14A
312
350
97
0
X
 
 
18218
HIGD1B
440
351
94
0
X
 
 
18217
HIGD1A
195
204
71
0
X
 
 
18216
acyl-carrier protein from Rickettsia prowazekii
405
350
78
0
X
 
 
18215
HsR50
829
704
169
0
X
 
 
18214
tstm1273
363
259
61
0
X
 
 
18211
Lotus domains 2 and 3
1140
834
179
0
X
 
 
18210
Conotoxin analogue [D-Ala2]BuIIIB
671
573
96
0
X
 
 
18209
DNA_molecule_G3ATG3ACACAG4ACG3
153
0
0
0
 
X
 
18206
Conotoxin analogue [D-Ala2]BuIIIB
141
71
25
0
X
 
 
18204
hPEBP1
167
531
167
0
X
 
 
18203
Mu-contoxin BuIIIB
141
70
30
0
X
 
 
18202
hNaa50p
140
544
140
0
X
 
 
18201
HasR N-terminal periplasmic signaling domain
525
403
107
0
X
 
 
18200
RstA_C
541
389
103
0
X
 
 
18199
DNA_1
48
0
0
0
 
X
 
18198
NIPP1 monomer
81
167
81
0
X
 
 
18197
angiogenin monomer
667
482
123
0
X
 
 
18196
proteinase inhibitor
495
451
124
0
X
 
 
18195
optn 550
141
98
32
0
X
 
 
18194
CarD1-72
404
296
73
0
X
 
 
18193
TtCdnLNt
391
278
58
0
X
 
 
18192
SGF73
218
175
44
0
X
 
 
18191
SGF11
204
144
45
0
X
 
 
18190
BC008182
431
244
75
0
X
 
 
18189
DocA
361
266
76
0
X
 
 
18188
CohA2
810
640
151
0
X
 
 
18187
Get5 carboxyl domain from A. fumigatus
378
321
75
0
X
 
 
18186
Get5 carboxyl domain from S. cerevisiae
361
270
65
0
X
 
 
18185
VHS-UIM monomer
165
0
165
0
X
 
 
18183
Vav2
713
431
116
0
X
 
 
18182
Vav2 and Arap3
768
455
111
0
X
 
 
18181
GspC-HR of typeII secretion system
398
260
72
0
X
 
 
18180
HmR11
1057
803
197
0
X
 
 
18179
E60A mutant AGR2
517
424
110
0
X
 
 
18178
AGR2 residues 41-175
199
480
135
0
X
 
 
18177
cytosolic region of human VIMP
81
241
81
0
X
 
 
18176
cytosolic region of human VIMP
81
169
81
0
X
 
 
18171
atTic-hip/hop domain (Residue 310-371)
371
262
67
0
X
 
 
18169
Ca-bound S100A4 in complex with non-muscle myosin IIA
1438
914
204
0
X
 
 
18167
PsbP
908
647
177
0
X
 
 
18166
HR4403E
791
560
141
0
X
 
 
18165
Enterohaemorrhagic E. coli (EHEC)
1001
584
158
0
X
 
 
18164
Neurotensin
97
0
0
0
X
 
 
18163
Neurotensin
96
0
0
0
X
 
 
18162
Neurotensin
98
0
0
0
X
 
 
18161
OR134
626
458
108
0
X
 
 
18160
SB2Jalpha
182
0
0
0
X
 
 
18159
SB1Jalpha
153
0
0
0
X
 
 
18158
N-terminal domain (6-74) of human ZBP1 protein
433
317
75
0
X
 
 
18157
Avh5
103
323
103
0
X
 
 
18156
HR6741A
555
420
101
0
X
 
 
18155
Neurolin Ig2
617
476
107
0
X
 
 
18153
thermomacin
282
125
67
0
X
 
 
18152
BA_SrtD
645
525
121
0
X
 
 
18151
CdnL
892
539
166
0
X
 
 
18148
VEGFR-2
48
0
0
0
X
 
 
18147
RbfA
136
393
136
0
X
 
 
18146
coprisin
223
0
0
0
X
 
 
18145
OR135
492
351
85
0
X
 
 
18142
PHD zinc finger
609
392
105
0
X
 
 
18141
novel conotoxin im23a from Conus imperialis
253
29
43
0
X
 
 
18138
MDR 769 homodimer
88
177
88
0
X
 
 
18137
Fam96a
103
460
105
0
X
 
 
18135
GLYCOSYLATED HUMAN INTERFERON ALPHA-2A [WITH GALNAC AT THR 106]
1007
731
178
0
X
 
 
18134
FIRST SAM DOMAIN OF ODIN
464
244
81
0
X
 
 
18133
AK1
858
777
187
0
X
 
 
18132
THERMOSTABLE PROTEIN FROM HYPERTHERMOPHILIC VIRUS SSV-RH
269
171
69
0
X
 
 
18130
monomeric Pstrx2
598
476
106
0
X
 
 
18126
Z-L2LBT
73
223
73
0
X
 
 
18125
avidin
705
418
120
0
X
 
 
18123
avidin
122
212
118
0
X
 
 
18122
Photoactive Yellow Protein
597
544
132
0
X
 
 
18121
CdnL N-terminal domain
408
271
70
0
X
 
 
18119
ITK-SH3
395
276
67
0
X
 
 
18118
BC040485
589
336
113
0
X
 
 
18115
C-terminal Domain (537-610) of Human Heat Shock Protein 70
406
310
78
0
X
 
 
18114
human LL-23
156
59
22
0
X
 
 
18113
allergenic beta parvalbumin
559
418
105
0
X
 
 
18112
HR4660B
522
530
146
0
X
 
 
18111
T7 transcription factor Gp2-E. coli RNAp jaw domain complex
634
499
113
0
X
 
 
18110
C-terminal RAGE (ctRAGE)
214
107
40
0
X
 
 
18109
MmpS4
73
227
73
0
X
 
 
18107
a major allergen from dust mite
529
291
94
0
X
 
 
18103
G_protein_alphai3_subunit
337
1000
337
0
X
 
 
18102
Cysteine Deleted Analog of Tachyplesin-1
84
0
0
0
X
 
 
18101
S100A1
473
371
90
0
X
 
 
18099
CIB1
229
591
159
0
X
 
 
18098
YT682A
682
488
111
0
X
 
 
18097
rhesus SPRY domain
319
326
143
0
X
 
 
18096
nAChR
630
552
127
0
X
 
 
18095
FR824D
636
464
112
0
X
 
 
18094
AF4-Af9 fusion
601
446
108
0
X
 
 
18093
transmembrane domains of the a4b2 nAChR
651
567
127
0
X
 
 
18092
NeRF1
837
522
152
0
X
 
 
18091
DP2
434
307
76
0
X
 
 
18090
DP1
448
321
76
0
X
 
 
18089
Post-translational S-nitrosylation
543
320
100
0
X
 
 
18088
Post-translational S-nitrosylation
542
321
100
0
X
 
 
18087
S100A1C85M
546
396
95
0
X
 
 
18086
YjdK
600
304
103
0
X
 
 
18085
Alvinellacin
83
0
0
0
X
 
 
18084
Calmodulin C-lobe bound with ER alpha peptide
244
129
67
0
X
 
 
18083
THP type 1 alpha 1 collagen fragment (772-786)
219
165
45
0
X
 
 
18082
Calmodulin N-lobe bound with ER alpha peptide
283
157
78
0
X
 
 
18081
apoCuA_polypeptide
646
477
117
0
X
 
 
18080
amyloid precursor protein's transmembrane domain
0
0
0
0
 
 
 
18079
UNAC Tetraloops
90
0
0
0
 
 
X
18078
AbpSH3-Srv17
65
0
65
0
X
 
 
18077
AbpSH3-Srv12
65
0
65
0
X
 
 
18076
AbpSH3-Sjl17
65
0
65
0
X
 
 
18075
AbpSH3-Scp17
64
0
64
0
X
 
 
18074
AbpSH3-Scp12
64
0
64
0
X
 
 
18073
AbpSH3-PRR
63
0
63
0
X
 
 
18072
AbpSH3-ArkA15_H(-6)A_K(-8)A
65
0
65
0
X
 
 
18071
AbpSH3-Prk17
65
0
65
0
X
 
 
18070
AbpSH3-ArkA_P(-1)A
65
0
65
0
X
 
 
18069
AbpSH3-ArkA_P(0)A
65
0
65
0
X
 
 
18068
AbpSH3-ArkA_P(2)V
64
0
64
0
X
 
 
18067
AbpSH3-ArkA_P(2)A
64
0
64
0
X
 
 
18066
AbpSH3-ArkA_P(-4)A
65
0
65
0
X
 
 
18065
AbpSH3-ArkA12
65
0
65
0
X
 
 
18064
AbpSH3-ArkA_L(-7)V
64
0
64
0
X
 
 
18063
AbpSH3-ArkA_L(-7)A
64
0
64
0
X
 
 
18062
AbpSH3-ArkA_K(3)A
65
0
65
0
X
 
 
18061
AbpSH3-ArkA_K(-3)V
60
0
60
0
X
 
 
18060
AbpSH3-ArkA_K(-3)R
60
0
60
0
X
 
 
18059
AbpSH3-ArkA_K(-3)A
65
0
65
0
X
 
 
18058
AbpSH3-ArkA_SI
65
0
65
0
X
 
 
18057
AbpSH3-ArkA_H(-6)A
65
0
65
0
X
 
 
18056
AbpSH3-ArkB
65
0
65
0
X
 
 
18055
AbpSH3-ArkA
65
0
65
0
X
 
 
18054
AbpSH3
65
0
65
0
X
 
 
18053
hs499
659
485
130
0
X
 
 
18052
MS2
185
0
0
0
X
 
 
18051
myb-like1 domain of hDMP1
318
230
57
0
X
 
 
18050
DNA_1
179
0
0
9
 
X
 
18049
RNA-binding subunit of the TRAMP complex
387
240
89
0
X
 
 
18048
NPM1_C70
241
276
73
0
X
 
 
18047
NP_814968.1
824
484
146
0
X
 
 
18046
D6
547
423
108
0
X
 
 
18045
EMAP2
900
518
139
0
X
 
 
18044
eight-stranded (beta/alpha)-barrel
1262
904
217
0
X
 
 
18043
Insect Defensin Lucifensin from Lucilia sericata
196
92
0
0
X
 
 
18042
EDC3_DCP2
540
436
101
0
X
 
 
18041
EDC3-LSm domain
490
386
93
0
X
 
 
18040
DNA_1
202
0
0
20
 
X
 
18039
Solution structure ensemble of the two N-terminal apple domains (residues 58-231) of Toxoplasma gondii microneme protein 4
850
641
161
0
X
 
 
18037
ykud_imip
836
643
164
0
X
 
 
18036
UNAC Tetraloops
89
0
0
0
 
 
X
18035
UNAC Tetraloops
88
0
0
0
 
 
X
18034
UNAC Tetraloops
89
0
0
0
 
 
X
18032
RPA2022
576
443
105
0
X
 
 
18031
Fap7
155
319
155
0
X
 
 
18029
sf-ALR
503
411
107
0
X
 
 
18028
CaM bound to NOS peptides
733
144
145
0
X
 
 
18027
CaM bound to NOS peptides
826
431
162
0
X
 
 
18026
guanylyl cyclase activating protein-1, GCAP1
131
324
131
0
X
 
 
18025
hUBR2 ubr-box
64
0
64
0
X
 
 
18023
Cyclo-TC1 Trp-cage
114
0
0
0
X
 
 
18022
Cx43 C-terminal domain bound to tubulin
144
0
0
0
X
 
 
18021
Mg2+ bound alpha1 I-domain
179
544
179
0
X
 
 
18020
Apo alpha1 I-domain
176
538
176
0
X
 
 
18019
U1-TRTX-Sp1a
188
56
26
0
X
 
 
18018
YP_916642.1
487
360
98
0
X
 
 
18017
RRM
512
366
94
0
X
 
 
18016
SSGCID
614
453
108
0
X
 
 
18015
PITX2
457
225
89
0
X
X
 
18014
Myristoylated Polyproline Type II Helix
124
0
0
0
X
 
 
18013
MS1
888
642
159
0
X
 
 
18012
N-terminal domain of human TIG3
609
452
103
0
X
 
 
18011
Tb24
1038
817
201
0
X
 
 
18010
FF11-60
308
217
51
0
X
 
 
18009
lambda_5_22-45_peptide
145
0
0
0
X
 
 
18008
Molecular system
369
200
67
0
X
 
 
18007
Molecular system
378
212
68
0
X
 
 
18006
Molecular system
370
203
67
0
X
 
 
18005
Molecular system
382
211
68
0
X
 
 
18004
Structural and functional analysis of the DEAF-1 and BS69 MYND domains
258
179
52
0
X
 
 
18003
apo-NmtR
509
412
108
0
X
 
 
18002
Kindlin-2
629
377
129
0
X
 
 
18001
AIP
979
737
163
0
X
 
 
18000
MRG
1125
870
204
0
X
 
 
17999
ATS
636
935
312
0
X
 
 
17998
FKBP42
170
682
170
0
X
 
 
17997
Cd(II) form of Desulforedoxin
194
0
0
0
X
 
 
17996
HIV-1 PR Homodimer
89
181
89
0
X
 
 
17995
NE2163
472
354
86
0
X
 
 
17994
HIV-1 PR Homodimer
88
177
88
0
X
 
 
17993
EC2
405
348
78
0
X
 
 
17992
Nicotinic_Acetylcholine_Receptor
689
334
127
0
X
 
 
17991
Nicotinic_Acetylcholine_Receptor
689
334
127
0
X
 
 
17990
MYRISTOYLATED ALPHA M
126
22
0
0
X
 
 
17989
UUP protein C-terminal domain
651
478
113
0
X
 
 
17988
Mesobuthus {alpha}-scorpion toxins affecting sodium channels
368
0
0
0
X
 
 
17987
Ts16
178
0
0
0
X
 
 
17986
cyclic gomesin
95
0
0
0
X
 
 
17985
BST-2
23
24
23
0
X
 
 
17983
C-CaM/PEP-19 complex
65
0
65
0
X
 
 
17982
C-CaM/Ca complex
71
0
71
0
X
 
 
17981
C-CaM/PEP-19 complex
69
0
69
0
X
 
 
17980
G-quadruplexes
159
0
0
0
 
X
 
17979
Zn(II) form of Desulforedoxin
189
0
0
0
X
 
 
17978
MPG1
531
382
103
0
X
 
 
17977
PPARgamma LBD + MRL20
170
499
169
0
X
 
 
17976
PPARgamma LBD + MRL24
186
512
186
0
X
 
 
17975
PPARgamma LBD + rosigliazone
245
750
245
0
X
 
 
17974
PAT Pyk2 and Paxillin LD motif
782
438
143
0
X
 
 
17973
onconase FLG variant
694
495
125
0
X
 
 
17972
U2/U6snRNA
130
80
0
0
 
 
X
17971
TGIF1
526
380
98
0
X
 
 
17970
RBM5-ZF1
200
0
0
0
X
 
 
17969
RBM5-ZF1
200
0
0
0
X
 
 
17968
HPV16_E6
469
259
83
0
X
 
 
17967
N-terminal domain of HPV16 E6 oncoprotein
472
264
83
0
X
 
 
17966
PDGFR-TM dimer
213
153
33
0
X
 
 
17965
NsR264
664
500
119
0
X
 
 
17964
HIV-1 PR Homodimer
90
172
90
0
X
 
 
17963
Rhodostomin G50L mutant
356
0
67
0
X
 
 
17962
putative oxidoreductase from Ehrlichia chaffeensis
395
381
99
0
X
 
 
17961
U2U6111
45
0
29
0
 
 
X
17960
Bubr1N Blinkin complex
904
715
162
0
X
 
 
17959
human HOIL-1L
648
513
121
0
X
 
 
17958
C9L,C14L-LeuA
162
126
36
0
X
 
 
17957
BA42
823
638
145
0
X
 
 
17956
MCoTI-V
165
0
0
0
X
 
 
17955
(C9S, C14S)-leucocin A
184
135
43
0
X
 
 
17953
NMR Structure of protoporphyrin-IX bound murine p22HBP
881
639
166
0
X
 
 
17952
C5 protein monomer
476
312
116
0
X
 
 
17950
AtTRB2
350
260
66
0
X
 
 
17949
CssII
361
0
0
0
X
 
 
17948
Hsp12
471
223
102
0
X
 
 
17947
GlbN holoprotein
134
0
115
0
X
 
 
17946
Dihydrofolate reductase from Moritella profunda
848
665
169
0
X
 
 
17945
TauF4 Fragment
99
214
99
0
X
 
 
17943
CGC-19
675
540
135
0
X
 
 
17942
Complex of hDlg and E6
609
460
111
0
X
 
 
17941
IV-B_RNA
243
179
47
2
 
 
X
17940
p38alpha
188
591
188
0
X
 
 
17939
a protein from Haloferax volcanii
255
98
55
0
X
 
 
17938
CAP-Gly
286
247
86
0
X
 
 
17936
dADAR-dsRBD1
457
263
75
0
X
 
 
17935
GATase subunit (monomer) of GMP Synthetase
691
395
185
0
X
 
 
17934
AIDA1 PTB domain
672
561
134
0
X
 
 
17932
monophosphorylated (747pY) beta3 integrin
277
0
50
0
X
 
 
17931
biphosphorylated (747pY, 759pY) beta3 integrin
281
213
48
0
X
 
 
17930
monophosphorylated (747pY) beta3 integrin
283
212
50
0
X
 
 
17929
AM2-BM2
24
14
24
0
X
 
 
17928
AM2-BM2
26
26
26
0
X
 
 
17927
putative thiol-disulfide oxidoreductase
849
644
153
0
X
 
 
17926
CP12 protein
254
187
53
0
X
 
 
17925
SEVI
125
39
0
0
X
 
 
17924
SEVI
178
38
0
0
X
 
 
17923
defensin Lc-def from germinated lentil seeds
266
54
45
0
X
 
 
17922
Nef
153
509
150
0
X
 
 
17921
GAAA tetraloop monomer
32
0
22
0
 
 
X
17920
tau-filaments
216
237
216
0
X
 
 
17919
ubiquitin
143
212
71
0
X
 
 
17918
TbPIN1
671
449
122
0
X
 
 
17917
Tfg1 C-terminal domain
124
179
61
0
X
 
 
17916
Tfg2
176
270
89
0
X
 
 
17915
SH3
59
114
59
0
X
 
 
17913
SH3C
259
186
61
0
X
 
 
17912
third SH3 domain of R85FL
342
229
66
0
X
 
 
17911
Mpro-C
629
360
129
0
X
 
 
17909
StarD5
344
705
190
0
X
 
 
17908
Acidic Scorpion Potassium Channel Toxins
132
0
0
0
X
 
 
17907
HMG_ACPI
585
418
108
0
X
 
 
17906
CurA
563
418
108
0
X
 
 
17905
GED_rrACBcs
631
490
111
0
X
 
 
17904
Iso-1-cytochrome
520
0
0
0
X
 
 
17903
Iso-1-cytochrome
522
0
0
0
X
 
 
17902
CCL2 (+carbohydrate)
846
621
163
0
X
 
 
17901
Spliceosome
36
17
12
0
 
 
X
17900
BfR322
698
525
130
0
X
 
 
17899
MS1
876
689
208
0
X
 
 
17898
CylR2
331
186
69
0
X
 
 
17897
CylR2
293
168
67
0
X
 
 
17896
CylR2
331
186
69
0
X
 
 
17895
CylR2
355
202
72
0
X
 
 
17894
CylR2
355
202
72
0
X
 
 
17893
CylR2 homodimer
432
251
74
0
X
 
 
17892
CylR2 homodimer
436
251
74
0
X
 
 
17891
kkgf
134
75
0
0
X
 
 
17890
CCL2 (free)
821
605
161
0
X
 
 
17889
NvVg
206
0
37
0
X
 
 
17888
Polyserine Tract of Apis mellifera Vitellogenin, residues 358-392
193
0
0
0
X
 
 
17887
alpha anomeric lesion
177
56
0
18
 
X
 
17886
holo-acyl carrier protein monomer
413
333
83
0
X
 
 
17885
DNA_dodecamer
73
0
0
0
 
X
 
17884
RAT BETA-AMYLOID
101
35
0
0
X
 
 
17883
Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNA
418
191
64
0
X
 
X
17882
CssII
343
0
0
0
X
 
 
17881
C-CaM apo form
71
0
71
0
X
 
 
17880
yeast protein
427
303
110
0
X
 
 
17879
Atg8K26P
949
681
154
0
X
 
 
17878
La(4-325)
260
687
260
0
X
 
 
17877
RNA (32-MER)
232
0
0
0
 
 
X
17876
Novel Toxin from De Venom of the Scorpion Tityus
169
0
0
0
X
 
 
17875
MUC2_Mucin_Domain_Peptide
54
42
6
0
X
 
 
17874
MUC2_Mucin_Domain_Peptide
50
40
5
0
X
 
 
17873
Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat
51
32
6
0
X
 
 
17872
MUC2_Mucin_Domain_Peptide
65
43
7
0
X
 
 
17871
Mucin Glycoprotein Recognition
54
34
6
0
X
 
 
17870
MUC2_Mucin_Domain_Peptide, SUGAR (2-MER)
65
37
6
0
X
 
 
17869
MUC2_Mucin_Domain_Peptide, SUGAR (3-MER)
76
48
8
0
X
 
 
17868
MUC2 Mucin Domain Peptide
43
27
5
0
X
 
 
17867
Myosin Binding Protein-C Motif
210
298
100
0
X
 
 
17866
S100P
452
327
85
0
X
 
 
17865
ViCin1-D1D2
703
499
114
0
X
 
 
17864
CTD monomer
467
356
92
0
X
 
 
17863
Rv0899
1011
919
218
0
X
 
 
17862
Staphylococcus aureus IsdH linker domain
488
357
82
0
X
 
 
17860
RNA (37-MER)
282
0
0
0
 
 
X
17859
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
155
0
0
0
 
X
 
17858
NAB2_404-483
474
268
80
0
X
 
 
17857
S100A1E32Q
553
415
101
0
X
 
 
17856
CesAB
128
191
94
0
X
 
 
17855
NHP1
462
386
89
0
X
 
 
17853
DTA
708
663
193
0
X
 
 
17852
beta phosphoglucomutase in a ternary complex with glucose-6-phosphate and trifluoroberyllate
200
634
200
0
X
 
 
17851
beta phosphoglucomutase inhibited with trifluoroberyllate
208
643
208
0
X
 
 
17850
yCaM_GS_CNA1
1036
757
199
0
X
 
 
17849
yCaM_123
695
511
130
0
X
 
 
17848
hCc
113
302
105
0
X
 
 
17847
hCc
112
298
104
0
X
 
 
17846
yCc
120
312
111
0
X
 
 
17845
yCc
120
310
111
0
X
 
 
17844
IscU:IscS
77
77
77
0
X
 
 
17843
GB98-T25I
92
100
48
0
X
 
 
17842
OprH
156
475
156
0
X
 
 
17841
GB98-T25I,L20A
299
238
59
0
X
 
 
17840
GB98
286
213
56
0
X
 
 
17839
Ga98
276
213
56
0
X
 
 
17838
Molecular Level Interaction of the Human Synaptotagmin I C2B domain with Inositol Hexaphosphate
915
597
142
0
X
 
 
17837
IscU
94
69
91
0
X
 
 
17836
IscU
200
344
99
0
X
 
 
17835
TDRD7
467
357
84
0
X
 
 
17834
shPrP, Thiamine
183
0
101
0
X
 
 
17832
HISTONE_CHAPERONE_RTT106
381
286
66
0
X
 
 
17831
nDsbD-ox
610
475
119
0
X
 
 
17830
nDsbD-red
625
489
122
0
X
 
 
17829
C2 Domain
145
440
145
0
X
 
 
17828
HOIL-1_Unl
511
391
90
0
X
 
 
17827
k2-n
461
398
103
0
X
 
 
17826
galectin-7
1332
1045
264
0
X
 
 
17825
HSJ1a
317
185
66
0
X
 
 
17824
Rbx1
387
321
76
0
X
 
 
17822
QFMF
846
488
150
0
X
 
 
17821
Human C30S/C59S-Cox17 mutant
219
244
54
0
X
 
 
17820
IsdH-N2N3 monomer
292
878
292
0
X
 
 
17818
FKBP-type peptidyl-prolyl cis-trans isomerase
604
378
116
0
X
 
 
17817
GPR
78
198
76
0
X
 
 
17816
Lcn972
375
0
0
0
X
 
 
17815
IMP1 KH34
127
428
127
0
X
 
 
17814
DNA Containing an Aristolactam II-dA Lesion
82
0
0
0
 
X
 
17813
NMR structure of the UHRF1 PHD domain
336
248
64
0
X
 
 
17812
R2 of histone H3 tail by UHRF1 PHD finger
442
240
64
0
X
 
 
17811
MsPTH
949
735
165
0
X
 
 
17809
AHSA1-like protein AHA_2358
778
592
158
0
X
 
 
17808
Structure of PHD domain of UHRF1 in complex with H3 peptide
426
244
66
0
X
 
 
17807
Ca2+/CaM L-selectin peptide complex
251
438
144
0
X
 
 
17806
YP_001302112.1
696
532
134
0
X
 
 
17805
single polypeptide chain
463
329
77
0
X
 
 
17804
AAT
316
966
316
0
X
 
 
17803
InsulinGR
308
145
0
0
X
 
 
17799
YP_001302112.1
650
488
124
0
X
 
 
17798
chicken AvBD2-K31A mutant
206
0
0
0
X
 
 
17797
Chicken AvBD2 defensin
215
0
0
0
X
 
 
17796
Abeta(1-40)
84
74
38
0
X
 
 
17795
Abeta(1-40)
86
71
39
0
X
 
 
17794
Abeta(1-42)
85
77
39
0
X
 
 
17793
Abeta(1-42)
86
75
40
0
X
 
 
17792
aurelin
223
107
39
0
X
 
 
17791
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
143
0
0
0
 
X
 
17790
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
152
0
0
0
 
X
 
17789
(5'S)-8,5'-cyclo-2'-deoxyadenosine
171
0
0
0
 
X
 
17787
(5'S)-8,5'-cyclo-2'-deoxyguanosine
164
0
0
0
 
X
 
17786
(5'S)-8,5'-cyclo-2'-deoxyguanosine
167
0
0
0
 
X
 
17785
KRas171GNP
123
368
123
0
X
 
 
17784
PhyRSL-NepR complex
1163
831
212
0
X
 
 
17783
DamX SPOR domain
618
457
114
0
X
 
 
17782
lsm57
133
274
133
0
X
 
 
17781
hexamer
198
620
198
0
X
 
 
17780
Human prion protein with E219K protective polymorphism
809
461
148
0
X
 
 
17779
the intermediate IIIb of the TdPI-short
317
0
0
0
X
 
 
17777
Solution structure of the N-terminal domain of the Shigella type III secretion protein MxiG
482
148
98
0
X
 
 
17776
chimeric Af1503 HAMP- EnvZ DHp homodimer; A219F variant
513
387
101
0
X
 
 
17775
chimeric Af1503 HAMP- EnvZ DHp homodimer
610
456
112
0
X
 
 
17773
MS1
197
590
197
0
X
 
 
17772
Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)
531
300
96
0
X
 
 
17771
CaM-OLFp complex
983
689
176
0
X
 
 
17770
VDRLBD
235
717
235
0
X
 
 
17769
Ubiquitin
470
348
83
0
X
 
 
17768
gp17
582
282
102
0
X
 
 
17767
cl-BABP/SS complex
677
548
129
0
X
 
 
17766
E133-222
485
266
89
0
X
 
 
17765
EAS
338
0
0
0
X
 
 
17764
Abeta
210
0
0
0
X
 
 
17763
TdPI
318
0
0
0
X
 
 
17762
BS-RNase
536
350
132
0
X
 
 
17761
NTL9
108
161
54
0
X
 
 
17760
p53 N-terminus
67
251
67
0
X
 
 
17759
murine prion protein (residues 121-232)
100
301
0
0
X
 
 
17758
murine prion protein (residues 121-232)
93
283
0
0
X
 
 
17757
human prion protein (residues 121-230)
174
257
0
0
X
 
 
17756
human prion protein (residues 121-230)
177
254
0
0
X
 
 
17755
Reg I-alpha monomer
741
552
144
0
X
 
 
17754
MucBP
685
513
127
0
X
 
 
17753
HR3111A dimer
309
236
51
0
X
 
 
17752
hPRLR-D2
689
549
112
0
X
 
 
17751
Diiron
745
404
126
0
X
 
 
17750
N-terminal domain of E3 ligase HECW2
680
508
119
0
X
 
 
17749
entity
749
407
126
0
X
 
 
17748
ERK2
186
569
186
0
X
 
 
17747
LpR145J
910
676
143
0
X
 
 
17746
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
160
0
0
0
 
X
 
17745
PFV RNase H
838
600
142
0
X
 
 
17743
IGFBP-2 N-terminal domain
80
234
80
0
X
 
 
17742
ETV6 R458
801
574
141
0
X
 
 
17741
ETV6 Q436
686
497
112
0
X
 
 
17740
Hck
170
482
170
0
X
 
 
17739
HopAB1Pph1448_220_320
533
388
90
0
X
 
 
17738
HIV-1 CA
1204
902
214
0
X
 
 
17737
HopPmal_281_385
598
430
108
0
X
 
 
17736
AHSA1-like protein CHU_1110
1013
757
182
0
X
 
 
17735
sf3636
739
528
120
0
X
 
 
17734
PipB2
773
575
132
0
X
 
 
17733
(R7G)-Crp4
172
0
0
0
X
 
 
17732
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
599
70
80
0
X
X
 
17731
(E15G)-Crp4
183
0
0
0
X
 
 
17729
C-Terminal domain of Ler
599
151
59
0
X
X
 
17726
conotoxin pc16a
59
33
0
0
X
 
 
17725
KSR1 CA1-CA1a domain
503
649
156
0
X
 
 
17724
KSR1 CA1-CA1a domain
136
281
136
0
X
 
 
17723
ChR145
787
616
152
0
X
 
 
17722
CBD12
232
373
232
0
X
 
 
17721
CBD12
218
610
218
0
X
 
 
17720
NGlpG
312
251
68
0
X
 
 
17719
esophageal cancer-related gene 2
378
289
64
0
X
 
 
17717
NMR Structure of Mouse ApoAI(1-216)
1167
660
230
0
X
 
 
17716
Cu(I)Cu(II)-CopK
350
252
68
0
X
 
 
17714
human prion protein mutant HuPrP(90-231, M129, V210I)
804
459
149
0
X
 
 
17713
Fpr4p(280-392)
719
532
120
0
X
 
 
17711
SMN-Gemin2 complex
1183
909
206
0
X
 
 
17710
DsbA and DsbB
67
1228
288
0
X
 
 
17709
N-myc
115
0
0
0
 
X
 
17708
N-myc
130
0
0
0
 
X
 
17707
SRSF2_RRM/RNA complex
583
268
97
0
X
 
X
17706
SRSF2
594
246
100
0
X
 
X
17705
SRSF2_RRM
556
264
96
0
X
 
 
17703
RDE-4DC
306
775
229
0
X
 
 
17702
protein complex for DNA replication
639
363
125
0
X
 
 
17701
ykud_no_mutations
949
732
187
0
X
 
 
17699
SOLUTION NMR STRUCTURE OF THE S4S5 LINKER OF HERG POTASSIUM CHANNEL
100
0
0
0
X
 
 
17698
Monomeric HP67 H41F
73
0
67
0
X
 
 
17697
G-quadruplex
127
0
0
0
 
X
 
17695
Extracellular domain of GLIC
144
354
144
0
X
 
 
17694
GH84A_CBM32-1
812
597
158
0
X
 
 
17693
RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptide
788
535
153
0
X
 
 
17692
Dynein Light Chain 8
180
260
88
0
X
 
 
17691
Sox2
470
370
80
0
X
 
 
17690
carnitine palmitoyltransferase 1A
152
112
40
0
X
 
 
17689
Uracil-DNA glycosylase inhibitor p56
323
0
58
0
X
 
 
17688
TfR85A
808
631
149
0
X
 
 
17687
PARP-1 BRCT domain
553
328
98
0
X
 
 
17686
L1ORF1p
1038
697
153
0
X
 
 
17685
Zuo1
510
373
93
0
X
 
 
17683
HR3023C
712
528
120
0
X
 
 
17682
RNA (31-MER)
157
39
8
0
 
 
X
17681
short chain LaIT 1
191
100
35
0
X
 
 
17680
CBLB-pY-H-RING
483
351
84
0
X
 
 
17678
HRas166
127
389
128
0
X
 
 
17675
NTL9 V3AI4A double mutant
210
317
105
0
X
 
 
17674
FGF1-SSR128129E
586
359
129
0
X
 
 
17673
TDRD7
443
306
78
0
X
 
 
17671
RNA (27-MER)
184
141
16
0
 
 
X
17670
AaR96
986
744
179
0
X
 
 
17669
Trp-Cage mini-protein with D-amino acid
125
0
1
0
X
 
 
17668
ZiaAn sub mutant
400
403
99
0
X
 
 
17667
TgMIC4-apple5 monomer
402
315
73
0
X
 
 
17665
synuclein tetramer
528
260
134
0
X
 
 
17664
ORF57 103-120
102
85
23
0
X
 
 
17663
ORF57 56-140
214
229
73
0
X
 
 
17662
srtx-m
144
0
0
0
X
 
 
17661
srtx-i3
146
0
0
0
X
 
 
17660
LmrA-NBD ADP complex
247
724
247
0
X
 
 
17659
stapled peptide SP6
106
0
0
0
X
 
 
17658
stapled peptide SP1
80
0
0
0
X
 
 
17657
stapled peptide SP2
87
0
0
0
X
 
 
17656
P1_endolysin_Lyz
685
632
183
0
X
 
 
17655
Human Telomeric DNA
189
0
0
0
 
X
 
17653
SAP30 and PAH3
910
699
174
0
X
 
 
17652
S108C mutant of Phosphomannomutase/Phosphoglucomutase
395
1077
395
0
X
 
 
17651
CheA
707
420
130
0
X
 
 
17650
AbrB
549
399
91
0
X
 
 
17647
6B
151
427
151
0
X
 
 
17646
Anamorsin
922
703
184
0
X
 
 
17645
myosin VI lever arm extension
533
305
83
0
X
 
 
17644
htt17
64
0
0
0
X
 
 
17643
YtvA Dimer
281
782
242
0
X
 
 
17642
htt17
66
0
0
0
X
 
 
17641
Yeast_frataxin_(Yfh1)
483
236
104
0
X
 
 
17640
EL222 monomer
515
437
167
0
X
 
 
17639
Ebolavirus Fusion Loop pH 7.0
302
228
58
0
X
 
 
17638
Ebolavirus Fusion Loop pH 5.5
286
137
48
0
X
 
 
17637
short Grx domain
571
312
112
0
X
 
 
17636
Grx domain
673
472
125
0
X
 
 
17635
FUS/TLS RRM domain
568
446
117
0
X
 
 
17634
Cytidine Repressor DNA-Binding Domain
304
169
62
0
X
 
 
17633
BC28.1
1197
671
224
0
X
 
 
17632
Syk/Vav complex
653
355
95
0
X
 
 
17629
Nbp2_SH3 and Ste20_peptide
482
280
71
0
X
 
 
17628
Alk1
402
361
84
0
X
 
 
17627
alpha-actinin
250
135
67
0
X
 
 
17626
Act2-EF34-palladin complex
52
103
54
0
X
 
 
17625
Microvirin:mannobiose complex
274
397
121
0
X
 
 
17623
Model of human U2AF65 tandem RRM1 and RRM2 domains with eight-site uridine binding
742
375
184
0
X
 
X
17622
Solution structure of the closed conformation of human U2AF65 tandem RRM1 and RRM2 domains
752
497
187
0
X
 
 
17621
Solution structure of the EF-hand domain of Human Polycystin 2
360
152
69
0
X
 
 
17620
D2 domain of human fibroblast growth factor receptor 4
454
343
87
0
X
 
 
17619
WALP19
112
0
22
0
X
 
 
17618
WALP19-P10 complex
117
0
23
0
X
 
 
17617
S4-3 voltage sensor peptide
186
0
0
0
X
 
 
17616
plasmodium falciparum ribosomal lateral stalk
470
342
124
0
X
 
 
17615
RfaH carboxyterminal domain
397
211
62
0
X
 
 
17614
UCP2
249
695
236
0
X
 
 
17613
OR36
847
598
139
0
X
 
 
17612
OR38
691
489
112
0
X
 
 
17611
Rmet_5065
808
624
159
0
X
 
 
17610
GppNHp-bound H-RasT35S mutant protein
979
719
184
0
X
 
 
17609
Hr4436B
313
238
67
0
X
 
 
17608
RLIP76-GAP-GBD
1527
1122
269
0
X
 
 
17607
RBBP1 tudor domain
575
488
116
0
X
 
 
17606
RBBP1 chromobarrel domain
400
327
73
0
X
 
 
17604
T4_L99A
262
248
158
0
X
 
 
17603
T4_L99A/G113A/R119P
327
474
159
0
X
 
 
17602
Phosphomannomutase/Phosphoglucomutase Monomer
407
1125
407
0
X
 
 
17601
MLV readthrough pseudoknot
182
92
0
0
 
 
X
17600
Par-6
556
427
103
0
X
 
 
17599
Par-6
695
529
123
0
X
 
 
17598
Solution Structure of PilP from Pseudomonas aeruginosa
613
367
107
0
X
 
 
17597
Rv0577
606
772
221
0
X
 
 
17596
DewA
580
432
123
0
X
 
 
17595
Nob1
901
704
160
0
X
 
 
17594
hs00411
488
356
96
0
X
 
 
17593
TM1_TM2 in TFE:water
447
313
89
0
X
 
 
17592
Anabaena Sensory Rhodopsin Transducer with DNA
93
306
93
0
X
X
 
17591
Anabaena Sensory Rhodopsin Transducer with F-tails
87
296
87
0
X
 
 
17590
Anabaena sensory rhodopsin transducer
83
281
83
0
X
 
 
17589
Prp24-RRM3
84
253
84
0
X
 
 
17588
AVR3a4
611
458
110
0
X
 
 
17586
Rv0020c_FHA
553
287
114
0
X
 
 
17585
Rv0020c_Nter
702
342
140
0
X
 
 
17584
Thp5
89
58
19
0
X
 
 
17583
thurincin H
132
111
29
0
X
 
 
17582
gamma-S-G18V
941
710
178
0
X
 
 
17581
Solution structure of the skeletal muscle and neuronal voltage gated sodium channel antagonist mu-conotoxin CnIIIC
114
11
0
0
X
 
 
17580
Myc G-quadruplex
161
0
0
0
 
X
 
17579
H/ACA RNP protein Nhp2p
529
430
114
0
X
 
 
17578
H/ACA RNP protein Nhp2p-S82W mutant
501
351
114
0
X
 
 
17577
Siderocalin Q83
558
613
151
0
X
 
 
17576
gamma-S-WT
963
727
183
0
X
 
 
17575
C domain of Rv0899
627
350
129
0
X
 
 
17574
yeast RNase III dsRBD complex with a non-canonical RNA substrate
444
326
87
0
X
 
 
17573
Anticodon Stem-loop (coi6y)
75
38
0
0
 
 
X
17572
i6A37 tyrASL
143
101
24
0
 
 
X
17571
MUTANT UNLIGANDED BOVINE NEUROPHYSIN
364
169
74
0
X
 
 
17569
.
813
393
148
0
X
 
 
17568
TASL3 (monomer)
94
82
0
0
 
 
X
17567
TASL2 (monomer)
101
77
0
0
 
 
X
17566
TASL1
71
62
0
0
 
 
X
17565
Unmodified Glycyl-tRNA(UCC) anticodon stem-loop
101
82
0
0
 
 
X
17564
Glycyl-tRNA(UCC)1B anticodon stem-loop
107
87
0
0
 
 
X
17563
glycyl-tRNA anticodon stem-loops
108
90
0
0
 
 
X
17562
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
150
0
0
0
 
X
 
17561
Unliganded Bovine Neurophysin
616
86
154
0
X
 
 
17560
FZL4 (monomer)
57
56
0
0
 
 
X
17559
FZL2 (monomer)
59
59
0
0
 
 
X
17558
CHR/DPC micelle
105
90
25
0
X
 
 
17557
human ribosomal protein P1/P2 heterodimer
605
401
0
0
X
 
 
17555
vbs1
162
324
163
0
X
 
 
17554
tandem UBA of USP13
578
351
119
0
X
 
 
17553
acyl CoA binding protein
471
367
97
0
X
 
 
17552
Ph SAM linker
98
203
98
0
X
 
 
17551
cI-BABP-GCDA complex
720
472
129
0
X
 
 
17550
RING
99
224
72
0
X
 
 
17549
mvWFA2 monomer
366
325
167
0
X
 
 
17547
Hevein-type Antifungal Peptide with a Unique 10-Cysteine Motif
225
0
0
0
X
 
 
17546
Phytochrome
591
587
148
0
X
 
 
17545
first domain of human PIN1 in complex with a human Smad3 derived peptide( resi 173-186)
251
65
42
0
X
 
 
17544
second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 (res 178-189) derived peptide
281
98
33
0
X
 
 
17543
first domain of human Smurf1 in complex with a human Smad1 derived peptide
254
44
17
0
X
 
 
17542
human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptide
193
49
19
0
X
 
 
17541
human Smurf1 in complex with a phosphorylated human Smad1 derived peptide
190
0
0
0
X
 
 
17540
human Yap in complex with a human Smad1 derived peptide
203
62
28
0
X
 
 
17539
first WW domain of human YAP in complex with a human Smad1 doubly-phosphorilated derived peptide
201
0
0
0
X
 
 
17538
second WW domain from human YAP in complex with a human Smad1 derived peptide
197
64
30
0
X
 
 
17537
Human minimembrane protein OST4
156
0
0
0
X
 
 
17536
Complex of SUMO1 with RanBP2 M-IR2 SIM peptide
178
224
92
0
X
 
 
17535
DNA/RNA hybrid
130
36
0
16
 
X
X
17534
SpaI monomer
783
564
137
0
X
 
 
17533
Sex Peptide from Drosophila melanogaster
235
77
36
0
X
 
 
17532
CaBP1
607
484
139
0
X
 
 
17531
circular proteins in legumes
150
0
0
0
X
 
 
17530
AHSA1-like protein RHE_CH02687 (1-152)
849
639
154
0
X
 
 
17529
Nedd4LW3/smad3 complex
276
61
22
0
X
 
 
17528
Extracellular domain of mouse Notch-1 EGF12
211
0
0
0
X
 
 
17527
Extracellular domain of mouse Notch-1 EGF12
219
0
0
0
X
 
 
17526
NusB/BoxA RNA
572
427
135
0
X
 
X
17525
ATR13
403
320
77
0
X
 
 
17524
hr55460a
955
695
156
0
X
 
 
17523
Norwalk virus protease
923
683
177
0
X
 
 
17521
BamC
1086
941
243
0
X
 
 
17520
Unmodified ASL_Tyr
136
116
41
16
 
 
X
17519
Starch Binding Domain 2 of beta/alpha-amylase
505
398
112
0
X
 
 
17518
Starch Binding Domain 1 of beta/alpha-amylase
515
421
112
0
X
 
 
17517
Anticodon Stem-loop of Bacillus subtilis tRNATYR
80
35
0
16
 
 
X
17515
INAD PDZ5 complexed with Kon-tiki peptide
643
335
109
0
X
 
 
17514
LZ-cJun dimer
40
78
40
0
X
 
 
17513
Immunity protein 7
150
244
81
0
X
 
 
17512
primase CTD
725
565
135
0
X
 
 
17511
LZ-GCN4 dimer
138
69
69
0
X
 
 
17510
protein ligand complex
1059
791
177
0
X
 
 
17509
YP_557733.1
809
462
159
0
X
 
 
17508
HR6430A
526
391
90
0
X
 
 
17507
DJ-1 protein
171
533
171
0
X
 
 
17506
N-terminal Domain of the Ribosomal Protein L9
107
160
54
0
X
 
 
17505
human muscle acylphosphatase polypeptide
510
386
103
0
X
 
 
17504
RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide
410
0
0
0
X
 
X
17503
fusb
168
501
169
0
X
 
 
17502
NUCLEAR AND CYTOPLASMIC POLYADENYLATED RNA-BINDING PUB1
587
451
100
0
X
 
 
17501
NP_344798.1
1197
834
208
0
X
 
 
17500
papiliocin
222
0
0
0
X
 
 
17497
SNX17-PX
456
370
105
0
X
 
 
17496
PA4608
768
573
153
0
X
 
 
17495
Thuricin CD
116
70
29
0
X
 
 
17494
Zinc knuckle in PRDM4
218
0
36
0
X
 
 
17493
MoCVNH-LysM module from the rice blast fungus Magnaporthe oryzae protein MGG_03307
774
407
168
0
X
 
 
17492
Thuricin CD
133
105
30
0
X
 
 
17491
L4C
464
389
126
0
X
 
 
17490
C-terminal domain of Prp24
679
492
121
0
X
 
 
17489
FF domain L24A mutant
123
120
66
0
X
 
 
17488
ErbB3tm
242
176
47
0
X
 
 
17487
monomer of ICL3 (residues A221 to K345) 5-HT1A
211
351
111
0
X
 
 
17485
mSin3A PAH2-Pf1 SID1 Complex
726
545
136
0
X
 
 
17484
HR6470A
456
285
65
0
X
 
 
17483
hsp12
361
293
99
0
X
 
 
17482
Hsp12
536
391
102
0
X
 
 
17481
SeR147
882
634
155
0
X
 
 
17479
human_SBDS
1350
953
248
0
X
 
 
17478
cIAP1 CARD
165
156
149
0
X
 
 
17477
Mouse MFG-E8 C2 Domain
821
573
160
0
X
 
 
17476
zinc-finger
564
313
89
0
X
 
 
17475
Structural basis of p63a SAM domain mutants involved in AEC syndrome
340
157
75
0
X
 
 
17474
CD147 Ig0 C66M Dimer
108
214
106
0
X
 
 
17473
Chimera monomer
140
0
146
0
X
 
 
17472
trpv5_peptide
43
39
25
0
X
 
 
17471
p38_alpha
273
585
273
0
X
 
 
17468
NS5A fragment (191-369) monomer
160
511
160
0
X
 
 
17467
VRN1_B3b
600
514
122
0
X
 
 
17466
Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)
531
300
96
0
X
 
 
17458
Thymosin-Alpha1
156
0
0
0
X
 
 
17456
THAP domain of human THAP11
460
342
76
0
X
 
 
17455
TrJPMP22-TDPC micellar complex
74
82
74
0
X
 
 
17454
PMP22-TDPC micellar complex
85
171
85
0
X
 
 
17453
ccl5
58
0
59
0
X
 
 
17452
Pitx2HD
402
237
89
0
X
X
 
17451
M2-1
731
533
129
0
X
 
 
17450
AS1p-TarEc
80
0
0
0
X
 
 
17449
tRNALys3UUU
131
0
0
0
 
 
X
17448
protein YP_546394.1
639
471
117
0
X
 
 
17447
MUP11
906
714
170
0
X
 
 
17446
SAP97NPDZ1
606
567
181
0
X
 
 
17444
LR11_SorLA
25
71
25
0
X
 
 
17443
Solution structure of human ubiquitin conjugating enzyme Rad6b
835
581
140
0
X
 
 
17442
LAK160-P12
49
0
0
0
X
 
 
17441
LAK160-P710
49
0
0
0
X
 
 
17440
trans-Resveratrol in complex with the cardiac regulatory protein Troponin C
9
0
0
0
X
 
 
17439
ubiquitin
70
135
70
0
X
 
 
17438
LAK160-P7
49
0
0
0
X
 
 
17437
Ube2S
136
262
136
0
X
 
 
17436
45-MER
363
76
0
0
 
 
X
17433
Integrin beta3
38
118
38
0
X
 
 
17432
Myristoylated msrA
421
393
196
0
X
 
 
17431
outer membrane protein RcsF
508
403
86
0
X
 
 
17430
Arenicin-2 dimer
291
201
56
0
X
 
 
17429
CpcC
683
522
113
0
X
 
 
17428
AIDA1 PTB domain
674
568
134
0
X
 
 
17427
p21 kinase inhibitory domain bound to Cdk2 and Cyclin A
57
92
57
0
X
 
 
17426
SFTI-OPN
71
0
0
0
X
 
 
17425
island 1 protein gp6
353
212
70
0
X
 
 
17424
Integrin 1
168
176
38
0
X
 
 
17423
Control DNA duplex
157
0
0
0
 
X
 
17422
Cidofovir DNA duplex
162
4
0
0
 
X
 
17421
C6orf130
874
649
161
0
X
 
 
17420
Chr148
626
548
140
0
X
 
 
17419
HTH-TYPE TRANSCRIPTIONAL REPRESSOR CYTR
304
169
62
0
X
 
 
17418
Pab PolII intein
1074
585
183
0
X
 
 
17417
LZ5
176
88
46
0
X
 
 
17416
LpxC/CHIR-090
1689
1095
266
0
X
 
 
17415
cytochrome P450cam
298
596
295
0
X
 
 
17414
RecA
714
288
137
0
X
 
 
17413
TRAP11
29
29
0
0
X
 
 
17412
GABARAPL-1 and NBR1-LIR complex
755
506
110
0
X
 
 
17411
CHIP
78
167
78
0
X
 
 
17410
C6
180
550
180
0
X
 
 
17409
triazole-linked DNA duplex
212
94
0
0
 
X
 
17408
HIV TAR RNA
177
0
0
0
 
 
X
17407
homeodomain
482
300
88
0
X
 
 
17406
5'-R(*GP*UP*GP*AP*AP*GP*CP*CP*CP*GP*U)-3'
156
24
8
20
 
 
X
17405
IPSE/alpha-1
622
475
102
0
X
 
 
17404
PTH-HA20 solution
635
541
183
0
X
 
 
17403
HlyB-C39
885
657
169
0
X
 
 
17402
LBR_Tudor_domain
388
230
69
0
X
 
 
17401
5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'
48
0
0
0
 
 
X
17400
TRAP11
29
29
0
0
X
 
 
17399
CBM3
789
583
147
0
X
 
 
17398
A protein from fission yeast
589
379
105
0
X
 
 
17397
RET_oncogene
209
0
0
0
 
X
 
17396
Zn bound FCS domain of hPh1
276
198
46
0
X
 
 
17395
CCR5
140
0
0
0
X
 
 
17394
amidated IAPP
188
0
0
0
X
 
 
17393
CBP bromodomain with small molecule of HBS
700
430
122
0
X
 
 
17392
complex of CBP bromodomain with small molucule J28
721
442
122
0
X
 
 
17391
protein from Haloferax volcanii
307
183
75
0
X
 
 
17390
OR32
1009
584
173
0
X
 
 
17389
HR5554A
969
569
162
0
X
 
 
17388
USP13
542
408
97
0
X
 
 
17387
RBM5 ZnF
33
69
33
0
X
 
 
17386
RBM10 ZnF
33
76
33
0
X
 
 
17385
TEX13A ZnF
33
71
33
0
X
 
 
17384
Complex SrcKD with Imatinib
215
685
215
0
X
 
 
17383
Crimean Congo Hemorrhagic Fever Virus Cytoplasmic Gn Tail
155
148
70
0
X
 
 
17382
Raf-1 kinase inhibitor protein
1047
755
181
0
X
 
 
17381
putative surface protein
399
228
84
0
X
 
 
17380
RBP56 ZnF
32
74
32
0
X
 
 
17379
5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3', 2-CARBOXYQUINOXALINE
209
0
0
0
 
X
 
17378
PROTEIN
560
345
92
0
X
 
 
17377
Sans CEN2
60
0
0
0
X
 
 
17376
hPCNA trimer complexed with C-terminal region of p21
276
676
258
0
X
 
 
17375
hPCNA trimer complexed with C-terminal region of p21
277
0
261
0
X
 
 
17374
ADF/Cofilin from Trypanosoma brucei
672
527
130
0
X
 
 
17373
pdz domain
90
277
90
0
X
 
 
17371
hs00113
395
305
77
0
X
 
 
17370
protein BVU 1572(27-141)
740
549
132
0
X
 
 
17369
MS2
634
472
112
0
X
 
 
17368
MS2
639
480
113
0
X
 
 
17367
cytotoxic T-lymphocyte antigen_2 (CTLA-2) like protein, crammer
73
224
74
0
X
 
 
17365
ASHH2 a CW domain
555
395
109
0
X
 
 
17364
PTB Domain of TENC1 in complex with the peptide of DLC1
822
484
133
0
X
 
 
17363
DomB
880
647
164
0
X
 
 
17362
E2-25K
171
558
171
0
X
 
 
17360
calcium-calmodulin complexes
143
9
0
0
X
 
 
17359
CfR130
423
314
74
0
X
 
 
17358
nectin-1
307
170
84
0
X
 
 
17357
PsbQ protein
380
401
112
0
X
 
 
17356
DGD2
98
0
0
0
X
 
 
17355
meACP
449
304
94
0
X
 
 
17354
high calcium androcam
886
587
162
0
X
 
 
17353
androcam
893
662
161
0
X
 
 
17352
Taf14 YEATS domain
559
392
107
0
X
 
 
17351
rG4 substituted Drew Dickerson dodecamer
127
0
0
11
 
 
 
17350
vbs2a
131
396
131
0
X
 
 
17347
PAP248-286
229
0
0
0
X
 
 
17346
PAP248-286
226
0
0
0
X
 
 
17345
PROTEIN
545
414
87
0
X
 
 
17344
CHD4-PHD2/H3K9me3 complex
426
248
61
0
X
 
 
17343
NOXO1b
209
443
135
0
X
 
 
17332
vbs2b
713
522
148
0
X
 
 
17331
GIP in Bicellular media
254
0
0
0
X
 
 
17330
GIP
243
0
0
0
X
 
 
17329
PROTEIN
238
603
162
0
X
 
 
17328
CIB1
205
515
131
0
X
 
 
17327
proteorhodopsin
708
783
223
0
X
 
 
17326
RP1
60
54
0
0
 
 
X
17325
Engrailed 2
718
520
127
0
X
 
 
17324
Mus81-winged helix domain
599
432
90
0
X
 
 
17323
HR6188A
976
721
172
0
X
 
 
17322
W protein of bacteriophage lambda
350
206
62
0
X
 
 
17321
W protein of bacteriophage lambda
345
203
61
0
X
 
 
17320
YP_926445.1
659
385
119
0
X
 
 
17319
NP_253742.1
690
479
126
0
X
 
 
17318
YP_001092504.1
775
542
140
0
X
 
 
17316
T box riboswitch Specifier domain and GA motif
408
347
18
0
 
 
X
17315
C-terminal dsRBD of the Fission Yeast DICER
581
316
100
0
X
 
 
17314
Nonphosphorylated Peptide Recognizing Domain
562
388
97
0
X
 
 
17313
dCstF-50(1-92)
82
259
82
0
X
 
 
17312
Tah1 complex with C-terminus of Hsp90 (MEEVD)
699
535
117
0
X
 
 
17311
DHFR.NADPH
933
592
173
0
X
 
 
17310
DHFR.TMP
826
440
161
0
X
 
 
17309
coronavirus stem-loop 2
123
35
0
4
 
 
X
17308
dCstF-50(1-65)
117
198
65
0
X
 
 
17307
HIV-1 Capsid in complex with stapled peptide Inhibitor
601
377
94
0
X
 
 
17306
NR1C
529
410
103
0
X
 
 
17305
NLRP12 PYD monomer
584
402
102
0
X
 
 
17304
OR28
807
481
132
0
X
 
 
17303
human liver fatty acid binding protein
786
0
140
0
X
 
 
17302
human liver fatty acid binding protein
784
0
140
0
X
 
 
17301
Sso7c4
347
0
55
0
X
 
 
17300
thioredoxin
616
473
110
0
X
 
 
17299
thioredoxin
621
460
110
0
X
 
 
17298
sso1118
662
510
113
0
X
 
 
17297
GLP-2
179
0
0
0
X
 
 
17296
GLP-2
179
0
0
0
X
 
 
17295
EC PROTEIN I/II
108
0
21
0
X
 
 
17294
EC PROTEIN I/II
104
0
20
0
X
 
 
17293
Zn-Dph4
786
525
135
0
X
 
 
17292
26-MER
232
173
91
0
 
 
X
17290
hNLG3cyt
650
517
110
0
X
 
 
17289
Stromal_Interaction_Molecule_2
805
431
141
0
X
 
 
17288
SaMazF
712
523
121
0
X
 
 
17287
M6P/IGF2_receptor
793
585
146
0
X
 
 
17286
hRpn13
627
536
130
0
X
 
 
17285
PHD finger (PHD1) from CHD4 (Mi2b)
332
215
55
0
X
 
 
17284
E2_lipoyl_domain
439
327
71
0
X
 
 
17283
Pae177
704
580
150
0
X
 
 
17282
IscU
523
394
98
0
X
 
 
17281
Alyteserin-1C
106
0
0
0
X
 
 
17280
BvR159
706
551
125
0
X
 
 
17279
rat epididymal lipocalin 12
926
728
182
0
X
 
 
17278
TgADF Monomer
601
478
109
0
X
 
 
17277
putative thioredoxin
861
650
149
0
X
 
 
17276
unbound Alk5 ectodomain
437
247
85
0
X
 
 
17275
thioredoxin
800
602
124
0
X
 
 
17274
IIA(CHITOBIOSE)-HPr COMPLEX OF THE N,N'-DIACETYLCHITOBOISE BRANCE OF THE E. COLI PHOSPHOTRANSFERASE SYSTEM
853
689
181
0
X
 
 
17273
human PIWI-like 1 PAZ domain with ssRNA (5'-pUGACA)
738
456
138
0
X
 
X
17272
Human PIWI-like 1 PAZ domain
738
456
138
0
X
 
 
17271
complex of GPS2 53-90 and SMRT 167-207
490
232
90
0
X
 
 
17270
Brd3 in complex with GATA-1 C-tail
755
589
141
0
X
 
 
17268
Thioredoxin_C
593
302
104
0
X
 
 
17267
uncharacterized thiredoxin-like protein
753
552
129
0
X
 
 
17266
SilB(440-521)
445
335
89
0
X
 
 
17265
Fusion protein
658
429
128
0
X
 
 
17264
calmodulin IQ motif complex
1040
713
193
0
X
 
 
17263
Small archaeal modifier protein 1 from Methanosarcina acetivorans
588
443
101
0
X
 
 
17262
Calcium bound S100A16
436
408
112
0
X
 
 
17261
APO S100A16
432
412
98
0
X
 
 
17260
UCHL1 S18Y variant
1146
842
236
0
X
 
 
17258
Pineapple Cystatin
820
549
144
0
X
 
 
17257
VirB7-Xac2622 monomer
658
518
122
0
X
 
 
17256
PROTEIN STE5
100
0
0
0
X
 
 
17255
GIP/Glutaminase L peptide complex
766
388
136
0
X
 
 
17254
GIP apo
723
502
131
0
X
 
 
17253
AMA1 inhibitor peptide
124
0
18
0
X
 
 
17252
BCMA
166
0
0
0
X
 
 
17251
SARS-CoV main protease N-terminal domain
1013
762
198
0
X
 
 
17250
GNA1946
1597
1186
282
0
X
 
 
17249
R2
771
606
160
0
X
 
 
17247
xeFn14
193
0
36
0
X
 
 
17246
DOMAIN_OF_A_CELL_WALL_SURFACE_ANCHOR_FAMILY_PROTEIN
940
660
172
0
X
 
 
17245
CCL21_SLC_6Ckine_Exodus-2
616
441
99
0
X
 
 
17244
PROTEIN
368
206
82
0
X
 
 
17243
PROTEIN
393
219
70
0
X
 
 
17242
Thioredoxin C
611
351
104
0
X
 
 
17241
YAP
232
193
46
0
X
 
 
17240
Influenza HA fusion peptide(G13A)
97
0
0
0
X
 
 
17239
UBA+Ub complex
369
201
65
0
X
 
 
17238
UBA
367
200
65
0
X
 
 
17237
hFn14
163
0
33
0
X
 
 
17236
Sco proteins
134
281
92
0
X
 
 
17235
ACP18
481
370
94
0
X
 
 
17234
Lrp_DNA-binding_domain
381
275
62
0
X
 
 
17233
PlyG
517
363
88
0
X
 
 
17232
PlyG (E.C.3.5.1.28)
976
530
183
0
X
 
 
17231
ArsD homodimer
109
336
109
0
X
 
 
17229
ZNF_DNA
147
0
0
0
X
X
 
17228
ZNF
112
0
0
0
X
 
 
17226
trHbN cyanomet
463
446
123
0
X
 
 
17213
Mouse prion protein (121-231) with the mutation Y169A
688
367
135
0
X
 
 
17212
Rap1 BRCT domain
409
344
89
0
X
 
 
17211
Ste2p TM1-TM3 (G31-R161)
263
382
128
0
X
 
 
17210
NBD(1-392)
331
1026
331
0
X
 
 
17209
NBD(1-388)
326
685
326
0
X
 
 
17208
NBD(1-388)
328
1015
328
0
X
 
 
17207
SnR168A
803
605
157
0
X
 
 
17206
VHD monomer
451
331
68
0
X
 
 
17205
Cox17y monomer reduced
64
201
67
0
X
 
 
17203
Acyl carrier protein
344
299
74
0
X
 
 
17202
Tandem SH2 domains of Spt6
1136
611
207
0
X
 
 
17201
little finger domain of Dpo4
118
200
118
0
X
 
 
17200
UHRF1 Tandem Tudor Domains/Histone H3 complex
950
644
160
0
X
 
 
17199
spRT6
427
380
88
0
X
 
 
17196
Cu-binding protein
375
290
73
0
X
 
 
17195
UBA monomer
50
155
50
0
X
 
 
17194
Oxki4a
205
0
0
0
X
 
 
17193
SEVI precursor peptide PAP
217
0
0
0
X
 
 
17192
HR4495E
702
518
128
0
X
 
 
17191
MvR76
964
712
170
0
X
 
 
17190
Complex Rpp30
180
465
180
0
X
 
 
17189
Rpp30
194
570
195
0
X
 
 
17188
35-MER
309
235
61
0
 
 
X
17177
visual arrestin
146
0
146
0
X
 
 
17176
BT_0084 lipoprotein
722
546
128
0
X
 
 
17175
SP_0782 homodimer
481
358
92
0
X
 
 
17174
Mouse prion protein
690
369
135
0
X
 
 
17173
Nrd1 CID
557
348
116
0
X
 
 
17172
RNase A C-dimer
101
0
98
0
X
 
 
17171
SWIRM
570
370
89
0
X
 
 
17170
tvMyb2_MRE-1
611
476
112
0
X
 
 
17169
HR4527E
493
283
82
0
X
 
 
17166
dN6
566
423
97
0
X
 
 
17165
WT
621
460
97
0
X
 
 
17163
Dronpa
171
340
171
0
X
 
 
17162
Dronpa
196
392
196
0
X
 
 
17161
Rna14p/Rna15p
979
744
166
0
X
 
 
17160
CBP21
872
652
179
0
X
 
 
17159
Affibody_Abeta
35
70
35
0
X
 
 
17158
PARP-1 Finger 2
603
366
110
0
X
 
 
17157
PARP-1 Finger 1
621
363
102
0
X
 
 
17156
Thiostrepton(red,14)
68
71
10
0
X
 
 
17155
Thiostrepton(epi,9)
64
68
9
0
X
 
 
17154
Thiostrepton(oxi,9)
62
68
9
0
X
 
 
17153
thiostrepton
67
71
11
0
X
 
 
17152
EcAMP1
217
0
0
0
X
 
 
17151
FKBP in complex with 1-{[(4-methylphenyl)thio]acetyl}piperidine
639
363
116
0
X
 
 
17150
phosphotransferase_IIB
559
419
109
0
X
 
 
17149
Fyn_SH3_A39V-N53P-V55L
437
314
122
0
X
 
 
17148
MS1
728
539
160
0
X
 
 
17147
Pitx2 homeodomain
395
306
79
0
X
 
 
17146
ApcA
552
431
107
0
X
 
 
17145
Pitx2 homeodomain R24H
406
310
78
0
X
 
 
17144
ApcA
547
419
108
0
X
 
 
17143
HYL1_dsRBD_1
156
264
80
0
X
 
 
17141
HYL1 second dsRBD
63
195
63
0
X
 
 
17139
ARC92VBD
872
584
156
0
X
 
 
17138
MBD2/p66-alpha complex
492
357
74
0
X
 
 
17137
YgaP
607
451
108
0
X
 
 
17136
GlpE
557
302
120
0
X
 
 
17133
EWS
152
120
38
0
X
 
 
17132
amino-terminal UBA domain of OTUD7A
397
302
73
0
X
 
 
17131
N-terminal domain of fibroin 1
496
458
131
0
X
 
 
17130
zif268-12bpDNA
82
175
82
0
X
X
 
17129
25-mer DNA oligomer
254
139
0
25
 
X
 
17127
IGF-II in complex with the mutant form of human domain 11
1110
768
215
0
X
 
 
17126
Heparanase 158-417
1369
797
258
0
X
 
 
17125
apo DHFR
846
564
152
0
X
 
 
17124
NP_888769.1
775
565
142
0
X
 
 
17113
PKC-delta C1A
385
295
72
0
X
 
 
17112
PKC-delta C1B
391
319
73
0
X
 
 
17111
Mupirocin_didomain_ACP
1001
660
180
0
X
 
 
17110
IGF2R
815
592
154
0
X
 
 
17108
Human Insulin Mutant
293
0
0
0
X
 
 
17107
Human Insulin Mutant
289
0
0
0
X
 
 
17106
36-MER, 7-DEAZA-7-AMINOMETHYL-GUANINE
319
229
67
0
 
 
X
17105
NP_954075.1
614
353
113
0
X
 
 
17104
YP_001336205
491
299
87
0
X
 
 
17103
calcium-sensitizer, dfbp-o, in complex with troponin C and the switch region of troponin I
535
266
85
0
X
 
 
17092
DNA-binding protein SATB1
449
326
79
0
X
 
 
17091
PROTEIN
228
0
0
0
X
 
 
17090
YP_399305.1
740
513
130
0
X
 
 
17089
SH3 monomer
439
319
75
0
X
 
 
17088
P6.1 hairpin
138
91
16
0
 
 
X
17087
Prion with Y169A, Y225A, Y226A mutation
678
363
135
0
X
 
 
17086
ASIP(93-126, P103A, P105A, P111A, Q115Y, S124Y)
160
0
0
0
X
 
 
17085
HLTF HIRAN domain
620
453
116
0
X
 
 
17084
prion
417
366
129
0
X
 
 
17083
65-MER
208
0
0
0
 
 
X
17082
mouse prion protein with mutation F175A
695
479
135
0
X
 
 
17081
Prion with Y169G mutation
687
480
135
0
X
 
 
17080
Shc-PTB complex with Integrin beta3
1082
720
181
0
X
 
 
17079
PROTEIN
411
254
50
0
X
 
 
17078
tRNALeu monomer
32
0
32
0
 
 
X
17077
SynArsC
681
506
123
0
X
 
 
17076
SynArsC
689
519
133
0
X
 
 
17075
TatAd
391
324
75
0
X
 
 
17074
SynArsC
697
541
137
0
X
 
 
17073
CBP in complex with p53 TAD
673
460
115
0
X
 
 
17072
Cbx7 H3K9me3 complex
385
251
44
0
X
 
 
17071
Cbx3 H3K9me3 complex
362
241
56
0
X
 
 
17070
talin domain C
850
484
166
0
X
 
 
17068
Yeast frataxin
480
210
92
0
X
 
 
17067
Complex hMia40-hCox17
461
526
148
0
X
 
 
17066
N-Terminal PAS Domain of HERG K Channel
733
531
146
0
X
 
 
17065
STAM1 VHS-UIM
177
523
177
0
X
 
 
17063
hPgn (K57D)rK3
324
0
91
0
X
 
 
17062
hPgn rK3
457
0
96
0
X
 
 
17050
Solution structure of the Tudor domain from Drosophila Polycomblike (Pcl)
376
220
66
0
X
 
 
17048
AP180 M5
92
151
45
0
X
 
 
17047
holoTrpR dimer A77V variant
87
187
88
0
X
 
 
17046
holoTrpR dimer L75F variant
100
189
100
0
X
 
 
17045
KSR1 CA1 monomer
885
621
159
0
X
 
 
17044
Rtt103 CTD complex
835
393
137
0
X
 
 
17042
nNOS fragment
119
315
119
0
X
 
 
17041
holoTrpR dimer
95
189
95
0
X
 
 
17040
TM VI
170
0
0
0
X
 
 
17039
MvR254A
572
458
119
0
X
 
 
17038
SlR115
498
390
96
0
X
 
 
17036
pja1 zinc finger domain
468
277
73
0
X
 
 
17035
asr4154
350
254
67
0
X
 
 
17034
shPrP(90-232)
492
0
136
0
X
 
 
17033
Nonsense mRNA reducing factor
470
288
75
0
X
 
 
17032
CKR-PNG
97
67
17
0
X
 
 
17031
SLR0335
877
650
156
0
X
 
 
17030
HR4694F
534
394
89
0
X
 
 
17029
Formin C potential GTPase binding domain
658
482
111
0
X
 
 
17028
Bacteriophage Lambda Tail Tube-gpV-C
436
343
91
0
X
 
 
17027
lynx1
404
40
79
0
X
 
 
17026
BtR375
454
334
91
0
X
 
 
17025
BvR153
452
337
76
0
X
 
 
17024
Znf_A20:ubiquitin complex
192
178
65
0
X
 
 
17023
Znf_A20
248
207
65
0
X
 
 
17022
CmR116
705
512
131
0
X
 
 
17021
MaR143A
608
460
121
0
X
 
 
17020
CV_0373(175-257) protein
536
382
100
0
X
 
 
17019
DAXX / Rassf1C complex
678
387
115
0
X
 
 
17018
DAXX helical bundle
593
428
96
0
X
 
 
17017
MmT2A
481
346
87
0
X
 
 
17016
CARMIL CAH3a/b domain bound to capping protein
474
1504
474
0
X
 
 
17015
CUPIENNIN 1A
225
35
0
0
X
 
 
17013
Tryptophan apo-repressor
88
182
88
0
X
 
 
17011
E2[296-331] segment of Hepaptitis C Virus
205
125
0
0
X
 
 
17010
Tryptophan apo-repressor
85
158
85
0
X
 
 
17009
mqsa_cterm
65
288
65
0
X
 
 
17008
SR10
194
456
140
0
X
 
 
17007
Alpha-mannosidase_binding_domain_of_Atg34
620
455
106
0
X
 
 
17006
Atg19
696
491
118
0
X
 
 
17005
trPRAI
674
503
137
0
X
 
 
17003
N-terminal Vpr peptides
284
0
0
0
X
 
 
17002
YP_510488.1
493
352
90
0
X
 
 
17001
ASIP(80-132,_P103A,_P105A,_Q115Y,_S124Y)
255
0
0
0
X
 
 
17000
E1-69 of Yeast V-ATPase
357
202
68
0
X
 
 
16999
CV0426
522
381
94
0
X
 
 
16998
HR4653B
492
286
82
0
X
 
 
16997
SF1141
648
484
115
0
X
 
 
16996
human Rad51D N
455
333
80
0
X
 
 
16995
bolA protein (ECH_0303)
369
272
66
0
X
 
 
16994
C-Terminus Calmodulin F92E
492
268
92
0
X
 
 
16992
RKIP
979
720
172
0
X
 
 
16991
NeR70A
842
642
153
0
X
 
 
16989
CYP33
436
330
77
0
X
 
 
16988
PtR41O
415
337
87
0
X
 
 
16986
DP1 subunit
447
183
72
0
X
 
 
16984
ALBP
224
690
224
0
X
 
 
16983
PHD3 finger of MLL
383
262
67
0
X
 
 
16982
D-allose binding protein
266
775
266
0
X
 
 
16981
SARS Coronavirus Nonstructural Protein Nsp7
500
293
93
0
X
 
 
16980
5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'
77
0
0
0
 
 
X
16979
ec0544
614
452
115
0
X
 
 
16978
CKR-brazzein
262
198
51
0
X
 
 
16977
nsp7a
631
506
127
0
X
 
 
16971
TraI 381-569
949
655
179
0
X
 
 
16970
Bem1p SH3-CI domain with Ste20p
812
546
122
0
X
 
 
16969
Sam68 Qua1 domain
249
176
39
0
X
 
 
16968
Derivative of HRF
280
58
0
0
X
 
 
16967
MAST2-PDZ/PTEN-C_Terminus
540
406
96
0
X
 
 
16963
U1-Liotoxin-Lw1a
231
0
0
0
X
 
 
16961
Dsy0195(21-82)_protein
392
289
69
0
X
 
 
16960
Solution structure of GxTX-1E
188
0
0
0
X
 
 
16958
ZCCHC9 in complex with Zn
683
415
152
0
X
 
 
16957
KvAP
817
424
136
0
X
 
 
16956
AlgE6R3
870
664
175
0
X
 
 
16955
calcium-bound CPV3
642
429
119
0
X
 
 
16954
NHR3/PKA(RIIa) Complex
735
470
134
0
X
 
 
16953
5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'
81
19
0
8
 
 
X
16952
5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'
95
29
5
10
 
 
X
16951
5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'
107
50
0
10
 
 
X
16950
5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'
85
29
4
10
 
 
X
16949
PDZ3 of ZO-1
98
193
98
0
X
 
 
16948
GTPase Effector Domain ( GED)
557
366
124
0
X
 
 
16947
histidine kinase receptor ArcB
425
317
108
0
X
 
 
16946
hERG1-135
729
522
141
0
X
 
 
16945
chicken parvalbumin 3
645
431
120
0
X
 
 
16944
CpR82G
282
244
61
0
X
 
 
16943
PatE1-34
202
0
0
0
X
 
 
16942
SR518
712
542
135
0
X
 
 
16941
47-MER
257
0
0
0
X
 
X
16940
Thrombin
253
525
253
0
X
 
 
16937
apoWCBD4-6
227
667
227
0
X
 
 
16936
MBD2 bound to a methylated DNA
530
307
70
0
X
X
 
16935
PECAM-1
206
186
47
0
X
 
 
16934
PBS domain
912
671
156
0
X
 
 
16933
FKBP12-rapamycin-FRB
94
185
94
0
X
 
 
16932
F2F3
198
207
198
0
X
 
 
16931
FKBP12-rapamycin
159
253
99
0
X
 
 
16930
F2
113
343
113
0
X
 
 
16929
TerD-CA2+
999
806
203
0
X
 
 
16928
hERG N-terminal domain
500
516
139
0
X
 
 
16927
protein_sur18c
487
386
96
0
X
 
 
16926
E._coli_lipoprotein
444
236
92
0
X
 
 
16925
FKBP12
164
258
97
0
X
 
 
16923
Smurf2 WW2 and WW3 bound to Smad7 PY
630
369
128
0
X
 
 
16922
histidine kinase receptor KdpD
102
257
102
0
X
 
 
16921
MinE dimer
520
377
95
0
X
 
 
16920
Tra2beta1 RRM in complex with AAGAAC RNA
569
280
92
0
X
 
X
16919
spMDD
268
832
268
0
X
 
 
16918
CKI1RD
154
318
154
0
X
 
 
16917
CKI1RD
156
315
156
0
X
 
 
16916
spMDD complex with ligands
280
855
280
0
X
 
 
16915
Human Insulin Mutant A22Gly-B31Lys-B32Arg
297
0
0
0
X
 
 
16914
UBX domain of human UBXD2
457
311
79
0
X
 
 
16913
squash aspartic acid proteinase inhibitor
550
421
0
0
X
 
 
16912
delta
1017
752
183
0
X
 
 
16911
VARC244
528
364
95
0
X
 
 
16910
Prestin STAS monomer
437
372
121
0
X
 
 
16909
IRTKS-SH3 and EspFu-R47 complex
484
285
71
0
X
 
 
16908
Ubiquitin like domain of UBLCP1
463
258
77
0
X
 
 
16907
HAfp
125
76
23
0
X
 
 
16905
Sma0114, response regulator
532
478
119
0
X
 
 
16904
alpha-synuclein
134
383
135
0
X
 
 
16902
ALS1 monomer
377
941
291
0
X
 
 
16901
Human Relaxin-like Factor
314
48
5
0
X
 
 
16900
MDM4-p53 complex
93
281
93
0
X
 
 
16898
alpha-haemoglobin:AHSP protein complex
112
120
112
0
X
 
 
16897
MTH1821
549
375
92
0
X
 
 
16895
UBB+1 (ubiquitin B mutant)
534
380
93
0
X
 
 
16894
MDM4-nutlin3 complex
80
250
80
0
X
 
 
16893
MDM4 N-terminal domain
66
215
66
0
X
 
 
16892
NS2[60-99]
215
0
0
0
X
 
 
16891
alpha haemoglobin in monomer-dimer equilibrium
113
219
113
0
X
 
 
16890
G61-101
240
122
43
0
X
 
 
16889
HIV-2 myrMA bound to di-C4-PI(4,5)P2
647
402
128
0
X
 
 
16888
HIV-2_myristoylated_matrix_protein
622
386
128
0
X
 
 
16887
HIV-2 unmyristoylated matrix protein
593
380
126
0
X
 
 
16886
HCV NS2 [27-59]
216
120
0
0
X
 
 
16885
UBM1-Ubiquitin complex
759
423
131
0
X
 
 
16884
RRM3 monomer
492
395
107
0
X
 
 
16883
H-REV107N
658
518
116
0
X
 
 
16882
Ubiquitin-Binding Motif
586
435
103
0
X
 
 
16881
polyketide cyclase SCO5315
820
654
175
0
X
 
 
16880
UBM2 in Complex with Ubiquitin
771
432
130
0
X
 
 
16879
PDZ3_PTP-BL
500
384
100
0
X
 
 
16878
Reecognition of H3 by the PHD Finger
270
163
47
0
X
 
 
16877
PROTEIN/RNA Complex
316
0
0
0
X
 
X
16876
ERD14
328
532
182
0
X
 
 
16874
rat Lipocalin-Type Prostaglandin D Synthase
745
599
153
0
X
 
 
16872
Mcm10 C-terminal DNA binding domain
577
282
98
0
X
 
 
16871
ZO-1 PDZ2
492
351
88
0
X
 
 
16870
Human Tubulin Cofactor C
681
370
108
0
X
 
 
16869
catalytic core of Dpo4
185
513
185
0
X
 
 
16868
NusA
706
508
119
0
X
 
 
16867
VAMP7(1-180)
117
0
117
0
X
 
 
16866
VAMP7(1-118)
108
0
108
0
X
 
 
16865
Tandem PHD finger of Human DPF3b
707
364
117
0
X
 
 
16864
uvi31+
418
401
111
0
X
 
 
16863
KipI-N
592
394
111
0
X
 
 
16862
CaBP1
607
484
139
0
X
 
 
16861
Tandem PHD finger of Human DPF3b
696
364
117
0
X
 
 
16860
holo acyl carrier protein
512
383
90
0
X
 
 
16859
histone_N-terminal_H3/double_PHD_fingers complex
716
364
117
0
X
 
 
16858
histone_H3_acet_lys_14/double_PHD_fingers complex
712
364
117
0
X
 
 
16857
Exon 6 of human Jagged-1
262
0
0
0
X
 
 
16856
acyl_carrier_protein
496
335
90
0
X
 
 
16854
eye lens fragment
66
0
0
0
X
 
 
16853
CD4mut
443
329
68
0
X
 
 
16852
siRNA construct
231
0
0
0
 
 
X
16851
KIX_ETAD1
548
438
112
0
X
 
 
16849
rubredoxin
264
0
0
0
X
 
 
16848
PFUC
398
221
88
0
X
 
 
16847
LC8 bound to residues 233-249 of neuronal Nitric Oxide Synthase
88
0
89
0
X
 
 
16846
Rv0899
619
511
118
0
X
 
 
16845
cementoin
33
93
33
0
X
 
 
16843
Abp1p
56
99
57
0
X
 
 
16842
PpcA
482
0
73
0
X
 
 
16841
Fibronectin 6FnI1-2FnII7FnI
853
498
186
0
X
 
 
16840
darcin
1010
781
186
0
X
 
 
16839
chemokine CCL27
561
409
95
0
X
 
 
16838
soluble tissue factor
204
543
204
0
X
 
 
16837
HAV 3C C24S
157
494
157
0
X
 
 
16835
Atg8
737
521
113
0
X
 
 
16834
5'-D(*DGP*DCP*DGP*DAP*DGP*(6MT)P*DTP*DCP*DTP*DGP*DCP*DG)-3'
137
0
0
0
 
X
 
16833
WR73
346
602
189
0
X
 
 
16832
C-terminal domain from mtTyrRS
719
524
137
0
X
 
 
16831
C-domain of Lsr2
244
196
54
0
X
 
 
16824
WASP/EspFU complex
620
444
111
0
X
 
 
16822
Bacillus anthracis dihydrofolate reductase
622
581
149
0
X
 
 
16819
culbertcidin
182
0
43
0
X
 
 
16818
PFUC_trans
398
221
87
0
X
 
 
16817
dermcidin-1L
233
0
47
0
X
 
 
16816
HR4547E
381
218
61
0
X
 
 
16815
mTZD_finger3
139
103
25
0
X
 
 
16814
mTZD_finger1
152
110
26
0
X
 
 
16813
complex of Ubl and SH3
723
406
150
0
X
 
 
16812
MED1:DNA complex
263
145
65
0
X
X
 
16811
SrtA
780
592
146
0
X
 
 
16810
PgR37A
897
667
169
0
X
 
 
16809
Itk SH3 and Itk SH2 domains
879
715
179
0
X
 
 
16808
HR3057H
302
233
54
0
X
 
 
16807
DhR1A
683
372
134
0
X
 
 
16806
SgR145
247
567
159
0
X
 
 
16805
RpR324
547
428
99
0
X
 
 
16804
Thermus thermophilus Rieske protein (cofactor bound)
131
336
131
0
X
 
 
16803
RanE66S dimer
413
310
67
0
X
 
 
16801
lmo0835
437
321
72
0
X
 
 
16800
HCV (Con1) NS5A-D3
82
252
82
0
X
 
 
16799
HCV (JFH-1) NS5A-D3
97
299
97
0
X
 
 
16798
HCV (JFH-1) NS5A-D3
97
306
97
0
X
 
 
16797
mTZD finger2
159
106
26
0
X
 
 
16796
Cdt1 binding domain(CBD) in complex with the MCM6 binding domain (MBD)
642
364
126
0
X
 
 
16795
KpR49
448
251
77
0
X
 
 
16794
ZR215
434
255
79
0
X
 
 
16792
SAP domain of MKL/myocardin-like protein 1
381
218
61
0
X
 
 
16791
yaiA
393
281
58
0
X
 
 
16790
CV0863
635
479
109
0
X
 
 
16789
usp7-ubl1
740
524
123
0
X
 
 
16788
NusG:NusE
746
410
120
0
X
 
 
16787
Thermus thermophilus Rieske protein (cofactor bound)
131
335
131
0
X
 
 
16786
cis-conomarphin
85
0
0
0
X
 
 
16785
conotoxin cis-mr3c
78
0
0
0
X
 
 
16784
conotoxin mr3c
83
0
0
0
X
 
 
16783
Smr dimer
86
244
86
0
X
 
 
16782
Photosystem II reaction center Psb28 protein
691
515
123
0
X
 
 
16781
dynein microtubule binding domain
116
364
116
0
X
 
 
16779
Lmo2-LIM2/Ldb1-LID
598
435
119
0
X
 
 
16778
CBX7/H3K27me2 complex
546
307
68
0
X
 
 
16777
hahellin
262
240
82
0
X
 
 
16774
Rv0543c
547
418
94
0
X
 
 
16773
CI-MPR domain5
785
570
153
0
X
 
 
16772
CI-MPR domain5
774
569
151
0
X
 
 
16771
alphaIIb_beta3
323
231
62
0
X
 
 
16770
PrgI mutant
474
335
89
0
X
 
 
16769
par toxin Fst in DPC micelles
153
0
0
0
X
 
 
16768
hEGF
224
184
48
0
X
 
 
16767
Reg IV
729
523
145
0
X
 
 
16766
BLM HRDC domain
518
373
88
0
X
 
 
16764
CALMODULIN
862
621
158
0
X
 
 
16750
c-src SH3
62
127
62
0
X
 
 
16749
Noxo1b PX domain
128
406
128
0
X
 
 
16748
AafA-dsc
762
607
136
0
X
 
 
16747
Glycocin A
230
125
43
0
X
 
 
16746
GmR58A
579
451
107
0
X
 
 
16745
Sm-AMP-1.1a monomer
182
90
0
0
X
 
 
16744
APLF
550
302
95
0
X
 
 
16743
HuPrP(90-231 M129 Q212P)
822
610
147
0
X
 
 
16742
Ribonuclease A
108
213
108
0
X
 
 
16741
holo-amicyanin
97
285
97
0
X
 
 
16740
Zn-amicyanin
98
0
96
0
X
 
 
16739
plectasin
195
148
42
0
X
 
 
16738
VRK1
1694
1170
337
0
X
 
 
16737
NMB1343
876
590
157
0
X
 
 
16736
P62 PB1 Dimer
192
0
192
0
X
 
 
16735
Anthrax Lethal Factor C-terminal
88
264
88
0
X
 
 
16734
PknB_PASTA34
734
378
148
0
X
 
 
16733
PknB_PASTA23
722
387
139
0
X
 
 
16732
PknB_PASTA12
728
392
146
0
X
 
 
16731
putative disulphide-isomerase
735
565
117
0
X
 
 
16729
SipDND38
265
801
274
0
X
 
 
16727
culbertcidin
247
0
0
0
X
 
 
16726
myristoylated NCS1
898
0
176
0
X
 
 
16723
mouse prion protein double mutant D167S, N173K
694
370
133
0
X
 
 
16722
mouse prion protein double mutant D167S, N173K
690
367
134
0
X
 
 
16721
BRD1 PHD1 finger
327
223
65
0
X
 
 
16720
mouse prion protein mutant D167S
424
366
131
0
X
 
 
16719
Crammer
311
215
73
0
X
 
 
16718
NI2C monomer
118
274
118
0
X
 
 
16717
NI3C monomer
149
280
149
0
X
 
 
16716
NI3C_Mut5 monomer
152
290
152
0
X
 
 
16715
Vaccinia_Related-Kinase_1
1694
1170
337
0
X
 
 
16714
AUCG tetraloop hairpin
104
104
30
13
 
 
X
16713
desulfothioredoxin
640
489
114
0
X
 
 
16712
desulfothioredoxin
641
481
114
0
X
 
 
16711
NP_415897.1
682
387
131
0
X
 
 
16710
spider roll
49
151
49
0
X
 
 
16709
LchB
144
84
0
0
X
 
 
16708
BRUNOL-3
891
798
197
0
X
 
 
16707
LchA
176
99
0
0
X
 
 
16706
H2H3
356
193
72
0
X
 
 
16705
SPI2 (T7A)
206
82
41
0
X
 
 
16704
SPI2 (T7Y)
212
0
0
0
X
 
 
16703
SPI2
204
111
38
0
X
 
 
16701
the C-terminal domain of Stt3p
237
714
236
0
X
 
 
16700
HSV-1 gH protein, gH626-639 fusion peptide
76
0
0
0
X
 
 
16699
HSV-1 gH protein, gH617-644 fusion peptide
163
0
0
0
X
 
 
16698
ORF57
391
361
119
0
X
 
 
16697
REF2-I
113
325
113
0
X
 
 
16696
ICP27
124
61
33
0
X
 
 
16695
Integrase Core Domain Dimer
150
462
150
0
X
 
 
16694
Human Polybromo/Histone 3 complex
687
379
113
0
X
 
 
16693
BTK2
131
114
31
0
X
 
 
16692
BvR106A
464
247
77
0
X
 
 
16691
SgR46
649
373
117
0
X
 
 
16690
C. albicans Ess1 prolyl isomerase
165
498
165
0
X
 
 
16689
PshDsbA
1138
880
200
0
X
 
 
16688
CPE1231
420
327
81
0
X
 
 
16687
ilvN
531
387
98
0
X
 
 
16686
lmo0835
553
428
101
0
X
 
 
16685
MreC
965
566
170
0
X
 
 
16684
MS1
420
308
91
0
X
 
 
16683
REF2-I/HSV-1 ICP27 peptide
899
627
159
0
X
 
 
16682
Q83/[GaIII(Ent)]3-
515
554
137
0
X
 
 
16681
HR5531E
461
350
73
0
X
 
 
16680
Nanog
577
396
81
0
X
 
 
16679
GNA 2132
712
524
133
0
X
 
 
16678
Sensory Rhodopsin II
1116
1004
239
0
X
 
 
16677
interferon-receptor complex
1351
0
285
0
X
 
 
16676
Oryctin
323
238
64
0
X
 
 
16675
protein-glutaminase
1049
797
205
0
X
 
 
16674
cytochrome c3
542
0
0
0
X
 
 
16673
BS3
256
781
256
0
X
 
 
16672
transmembrane domain of the n-acetylcholine receptor beta2 subunit
750
458
134
0
X
 
 
16671
EH-domain proteins with specific NPF-containing partners
697
365
92
0
X
 
 
16670
NALP1_PYD
502
285
102
0
X
 
 
16669
RhoA GTPgS monomer
118
313
117
0
X
 
 
16668
RhoA-GDP monomer
270
479
152
0
X
 
 
16666
Sd5
405
270
65
0
X
 
 
16665
AeSCP-2-PA
674
376
112
0
X
 
 
16664
lambda lysozyme
315
302
151
0
X
 
 
16663
HUMAN INSULIN MUTANT
287
0
0
0
X
 
 
16662
AeSCP-2
657
375
113
0
X
 
 
16661
TP-ACP
119
238
119
0
X
 
 
16660
Substance P-NK1 complex
82
0
0
0
X
 
 
16659
pSic1_T90X
75
171
75
0
X
 
 
16658
B1B2
511
351
78
0
X
 
 
16657
Sic1_T90X
159
263
90
0
X
 
 
16656
Q251Q8_DESHY
392
289
69
0
X
 
 
16655
5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*CP*AP*UP*AP*CP*CP*CP*CP*GP*A)-3'
126
0
0
0
 
 
X
16654
5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*(N)P*AP*UP*AP*CP*CP*CP*CP*GP*A)-3'
130
0
0
0
 
 
X
16653
HtrA_PDZ
640
376
119
0
X
 
 
16652
asl3597
490
370
79
0
X
 
 
16649
CtR69A
352
255
63
0
X
 
 
16648
UuR17A
669
508
120
0
X
 
 
16647
CPF_0587
402
307
76
0
X
 
 
16646
RBD1,2 domains from human nucleolin
915
725
180
0
X
 
 
16643
CD2AP SH3-C monomer
216
118
61
0
X
 
 
16642
CD2AP SH3-B monomer
362
0
0
0
X
 
 
16641
CD2AP SH3-A monomer
120
114
60
0
X
 
 
16640
HR3102A
468
259
84
0
X
 
 
16639
V of beta2-glycoprotein I and ligand-binding module complex
104
0
104
0
X
 
 
16638
NHERF1_(150-358)
1055
758
174
0
X
 
 
16637
PDZ2-270
727
495
123
0
X
 
 
16636
ComAC
317
292
69
0
X
 
 
16635
N_delta
609
452
105
0
X
 
 
16634
ddIhh-V67CM
132
0
132
0
X
 
 
16633
prokineticin Bv8
387
0
0
0
X
 
 
16632
Kalirin
1178
897
199
0
X
 
 
16630
stnIIY111N
1028
750
195
0
X
 
 
16629
SlyD
897
655
161
0
X
 
 
16628
MloK1 CNBD monomer
736
540
134
0
X
 
 
16627
Protein GB1
198
161
55
0
X
 
 
16626
Ubiquitin
263
210
72
0
X
 
 
16624
acyl carrier protein from a fungal type I polyketide synthase
495
365
93
0
X
 
 
16623
E4B
479
210
76
0
X
 
 
16622
SH3 monomer
423
322
74
0
X
 
 
16621
KCNE3
95
286
96
0
X
 
 
16620
hs00184
343
244
60
0
X
 
 
16619
Diva (Boo)
924
699
162
0
X
 
 
16618
J-domain of CbpA
420
331
70
0
X
 
 
16617
ATH
609
428
110
0
X
 
 
16616
monomer
752
362
139
0
X
 
 
16615
HU-beta2
76
239
76
0
X
 
 
16614
a single polypeptide chain
667
457
126
0
X
 
 
16613
SUD-MC
1159
675
201
0
X
 
 
16611
SUMO-1 Daxx SIM complex
685
493
120
0
X
 
 
16610
AsnRS
688
496
119
0
X
 
 
16609
rna-ligand complex
205
180
27
11
 
 
X
16608
Proinsulin
476
271
83
0
X
 
 
16607
AL-09 H87Y
1269
906
229
0
X
 
 
16606
kI O18/O8 Y87H
1270
904
228
0
X
 
 
16605
MAUROCALCINE
226
0
0
0
X
 
 
16604
rna-ligand complex
198
174
26
0
 
 
X
16603
IscU
617
457
111
0
X
 
 
16602
KCNE3
98
264
91
0
X
 
 
16601
HCV Core-E1 signal peptide
134
75
0
0
X
 
 
16600
cgGFP
361
612
209
0
X
 
 
16599
clytin monomer
531
542
194
0
X
 
 
16598
cTEM-17m
228
680
228
0
X
 
 
16596
APLF
508
288
87
0
X
 
 
16594
atc0888
641
457
110
0
X
 
 
16593
F98N-fdx
491
33
79
0
X
 
 
16592
BT9727_4915
270
149
53
0
X
 
 
16591
LAIR-1
475
0
97
0
X
 
 
16590
EF-hand domain of polycystin-2
399
157
76
0
X
 
 
16589
PthA
223
0
0
0
X
 
 
16588
Aha1 monomer
122
385
122
0
X
 
 
16587
W60G beta2-microglobulin
332
0
65
0
X
 
 
16586
3F5_VHH
95
181
94
0
X
 
 
16585
SNase140
811
579
135
0
X
 
 
16578
DSY1790
708
394
132
0
X
 
 
16577
Homeodomain DNA complex
126
211
70
0
X
X
 
16576
Protein BH0266 From Bacillus halodurans
613
358
113
0
X
 
 
16572
Lamin-B1
694
398
134
0
X
 
 
16571
ML4
472
414
93
0
X
 
 
16570
YbbR family protein Dhaf_0833
538
409
94
0
X
 
 
16569
cgr26a
751
573
155
0
X
 
 
16568
DhR29a
416
353
80
0
X
 
 
16567
Nab3 RRM
318
201
60
0
X
 
 
16564
Atu1219
528
421
107
0
X
 
 
16563
Lin0431
661
474
117
0
X
 
 
16562
ROSSMANN 2x2 FOLD PROTEIN
688
497
115
0
X
 
 
16561
BcR147A
537
422
94
0
X
 
 
16560
protein from gene locus NE0665
538
405
98
0
X
 
 
16559
MAGI-1 PDZ1 / E6CT
697
481
105
0
X
 
 
16558
MAGI-1 PDZ1
737
555
125
0
X
 
 
16557
ErR9A
511
285
89
0
X
 
 
16556
SCO3027
308
234
51
0
X
 
 
16555
CA-CTD dimer
472
272
91
0
X
 
 
16551
ARNO-p
152
0
0
0
X
 
 
16550
ARNO(375-400)
136
0
0
0
X
 
 
16549
Mus81_NTD
456
258
73
0
X
 
 
16548
monomer A53T alpha-synuclein
133
0
133
0
X
 
 
16547
monomer E46K alpha-synuclein
133
0
133
0
X
 
 
16546
monomer A30P alpha-synuclein
132
0
132
0
X
 
 
16545
CV0237
405
306
64
0
X
 
 
16544
RECQL4
333
243
52
0
X
 
 
16543
monomer alpha-synuclein
133
0
133
0
X
 
 
16542
Pdcd4 MA-3 M-C
269
643
269
0
X
 
 
16541
Nurr1 monomer
195
566
196
0
X
 
 
16540
nasonin-1M
177
0
0
0
X
 
 
16539
nasonin-1
167
0
0
0
X
 
 
16538
Pdcd4 MA-3M
880
658
157
0
X
 
 
16537
UCH-L1
295
597
203
0
X
 
 
16536
Wilson Disease Associated Protein
665
523
141
0
X
 
 
16534
DCL4 DUF283
428
246
85
0
X
 
 
16533
hexadecanoyl-ACP
69
0
69
0
X
 
 
16532
tetradecanoyl-ACP
71
131
71
0
X
 
 
16531
dodecanoyl-ACP
71
138
71
0
X
 
 
16530
decanoyl-ACP
71
131
71
0
X
 
 
16529
octanoyl-ACP
71
140
71
0
X
 
 
16528
Modified Fatty Acid Synthase Acyl Carrier Protein
479
261
82
0
X
 
 
16527
Modified Fatty Acid Synthase Acyl Carrier Protein
484
260
81
0
X
 
 
16526
Modified Fatty Acid Synthase Acyl Carrier Protein
480
248
82
0
X
 
 
16525
Modified Fatty Acid Synthase Acyl Carrier Protein
481
269
82
0
X
 
 
16524
Modified Fatty Acid Synthase Acyl Carrier Protein
481
269
82
0
X
 
 
16523
pfColA monomer
429
576
207
0
X
 
 
16522
hDpl(122-139)
131
0
0
0
X
 
 
16520
hPar3 PDZ2
496
393
99
0
X
 
 
16519
SDF1a H25R
449
306
75
0
X
 
 
16518
Tc GPXI monomer
323
473
149
0
X
 
 
16517
BR7
652
519
118
0
X
 
 
16516
APE1 (39-318)
237
766
237
0
X
 
 
16515
mPar3 PDZ2
521
407
108
0
X
 
 
16514
syb96
88
272
88
0
X
 
 
16512
syb60-116
168
151
55
0
X
 
 
16511
hDpl(122-139)D124N
133
0
0
0
X
 
 
16510
first PHD finger/non-modified histone H3 tail complex
417
243
64
0
X
 
 
16509
CR1618
101
193
101
0
X
 
 
16508
synaptobrevin
561
360
106
0
X
 
 
16507
MmPar3 PDZ3, MmVE-Cadherin
697
499
137
0
X
 
 
16506
monomer
71
136
71
0
X
 
 
16505
octarepeats
255
160
50
0
X
 
 
16504
Human cannabinoid receptor 1 - helix 7/8 peptide
214
0
0
0
X
 
 
16503
RNase A
239
359
118
0
X
 
 
16502
aFGF-NTS
668
0
0
0
X
 
 
16501
(1-153)Apomyoglobin pH 2.40 (ref. DSS)
141
404
141
0
X
 
 
16500
(1-119)Apomyoglobin pH 2.40
112
341
112
0
X
 
 
16499
(1-77)Apomyoglobin pH 2.40
76
227
76
0
X
 
 
16498
CLOLEP_01837
628
475
113
0
X
 
 
16497
Integrin aIIbb3 transmembrane complex
326
203
71
0
X
 
 
16496
integrin alphaIIb beta3 transmembrane-cytoplasmic heterocomplex
684
528
140
0
X
 
 
16495
PYD peptide from ErbB2
94
0
0
0
X
 
 
16494
aFGF
728
0
0
0
X
 
 
16493
aFGF/MIHS complex
751
0
0
0
X
 
 
16492
Anti-TRAP
286
223
53
0
X
 
 
16491
peptidyl-prolyl cis-trans isomerase/Cycloheximide-N-ethylethanoate complex
656
325
116
0
X
 
 
16490
sf3929
508
369
88
0
X
 
 
16489
IBDV_pep46
228
0
0
0
X
 
 
16487
HCV-1b Core+1/S
48
157
48
0
X
 
 
16486
GTP pyrophosphokinase
506
368
94
0
X
 
 
16485
THAP RRM1
834
351
84
0
X
X
 
16484
CIP75_UBA
311
162
58
0
X
 
 
16483
CR17 from LRP-1 and ApoE
527
398
85
0
X
 
 
16482
LRP-1
244
169
40
0
X
 
 
16481
pfLamA (50% Ca2+)
1396
1044
260
0
X
 
 
16480
LDLR
501
352
92
0
X
 
 
16479
G-riboswitch terminator hairpin
119
90
0
0
 
 
X
16478
UBA
638
445
109
0
X
 
 
16477
e1 peptide
169
0
0
0
X
 
 
16476
ATC0905
683
514
122
0
X
 
 
16475
LpxC-L-161,240 complex
526
824
275
0
X
 
 
16473
Rv3250c
351
265
71
0
X
 
 
16472
TENC1
655
337
103
0
X
 
 
16471
IQGAP1 (401-533)
115
237
115
0
X
 
 
16470
ShcA PTB domain-NPLH peptide
153
264
153
0
X
 
 
16468
PcTx1
249
161
42
0
X
 
 
16467
AML1-ETO/HEB peptide complex
616
456
108
0
X
 
 
16466
plasminogen kringle 5
421
0
95
0
X
 
 
16465
CaM-peptide
1036
758
191
0
X
 
 
16464
alf4-tsa-PGK
363
1049
363
0
X
 
 
16463
kIV light-chain variable domain of immunoglobulin
567
429
110
0
X
 
 
16452
pUL89
394
0
0
0
X
 
 
16451
adp-PGK
355
701
355
0
X
 
 
16450
YSK2
555
398
109
0
X
 
 
16449
XPF DNA complex
365
199
73
0
X
X
 
16447
apo-PGK
364
1058
364
0
X
 
 
16446
monomer
866
600
184
0
X
 
 
16445
K2
260
174
43
0
X
 
 
16444
SC35
874
668
155
0
X
 
 
16443
cytochrome c3
625
0
0
0
X
 
 
16442
At3g03773.1
914
671
140
0
X
 
 
16441
ATP-bound N-MNK
960
675
193
0
X
 
 
16440
human Menkes protein
936
671
188
0
X
 
 
16439
factor H (modules 10-15)
640
508
127
0
X
 
 
16438
LDTI - IIc
208
0
0
0
X
 
 
16437
LDTI_-_IIb
213
0
0
0
X
 
 
16436
LDTI_-_IIa
222
0
0
0
X
 
 
16435
LDTI
229
0
0
0
X
 
 
16431
TAR-2Lig
236
172
57
0
X
 
X
16430
Nep1 dimer
390
1198
390
0
X
 
 
16428
KlcA and ArdB proteins
731
559
149
0
X
 
 
16426
murine Ets-1
675
503
119
0
X
 
 
16425
rna15, hrp1, anchor RNA 3' processing ternary complex
472
280
88
0
X
 
X
16424
BamE
442
349
89
0
X
 
 
16413
C17orf37
617
457
115
0
X
 
 
16412
Rtt103 bound to CTD peptide
835
393
137
0
X
 
 
16411
Rtt103 CTD interacting domain
850
570
150
0
X
 
 
16409
beta-phosphoglucoutase
210
415
210
0
X
 
 
16408
periplasmic CopK protein complex
426
278
73
0
X
 
 
16407
W2W11 Monomer
74
0
0
0
X
 
 
16406
peptidyl-prolyl cis-trans isomerase
610
322
109
0
X
 
 
16405
Ataxin-3/Ubiquitin complex
197
133
41
0
X
 
 
16404
Human ubiquitin-conjugating enzyme E2G2 isoform 1
910
715
165
0
X
 
 
16403
GLUTAREDOXIN
498
281
90
0
X
 
 
16402
human Ataxin-7-L3
476
328
91
0
X
 
 
16401
DHPCN
128
388
128
0
X
 
 
16400
ABC collagen heterotrimer
46
18
5
0
X
 
 
16399
W4W9 Monomer
72
0
0
0
X
 
 
16398
Psb27
522
379
121
0
X
 
 
16397
human ataxin-7
468
0
0
0
X
 
 
16396
CBD
627
414
109
0
X
 
 
16395
M.HhaI-DNA-cofactor ternary complex
276
557
276
0
X
 
 
16394
deltaF508 CFTR NBD1-RE monomer
114
0
114
0
X
 
 
16393
CFTR NBD1-RE monomer
170
166
170
0
X
 
 
16390
ubiquilin 1
458
328
79
0
X
 
 
16389
NP_247299.1
663
367
113
0
X
 
 
16388
NsR431C
810
612
154
0
X
 
 
16387
OR15
495
349
84
0
X
 
 
16386
Human Fibulin-4
351
264
67
0
X
 
 
16385
PF1109
640
498
114
0
X
 
 
16384
SR232
531
382
72
0
X
 
 
16382
Alr3790
713
534
143
0
X
 
 
16381
VDAC-1
316
513
233
0
X
 
 
16380
gi-13879369
811
471
153
0
X
 
 
16379
human interleukin 1alpha
649
493
129
0
X
 
 
16378
GtR34C
435
324
76
0
X
 
 
16377
RPA3574
379
287
72
0
X
 
 
16376
OR8w187r
810
614
139
0
X
 
 
16375
NleG2-3
609
432
104
0
X
 
 
16374
NleG2-3
609
432
104
0
X
 
 
16373
SPA4288
673
379
118
0
X
 
 
16372
af2351
837
574
114
0
X
 
 
16371
DSY2949
863
486
142
0
X
 
 
16370
Human Myotilin
608
458
113
0
X
 
 
16368
Mb0332
570
431
116
0
X
 
 
16367
CFTR NBD1-RE monomer
197
593
197
0
X
 
 
16366
TM1076
789
621
133
0
X
 
 
16365
YOR252W
641
514
133
0
X
 
 
16364
Mb1858
775
586
150
0
X
 
 
16363
CBP
306
236
49
0
X
 
 
16362
monomer
946
412
178
0
X
 
 
16361
p62 PB1
584
352
88
0
X
 
 
16360
S100A1 (aa) dimer
548
417
100
0
X
 
 
16359
NS2B_NS3pro
200
0
200
0
X
 
 
16357
TR5
610
434
100
0
X
 
 
16356
5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*(INO)P*GP*GP*TP*TP*AP*GP*GP*GP*T)-3'
210
0
0
0
 
X
 
16355
AR3449A
442
342
81
0
X
 
 
16354
A1AO ATP synthase
313
155
52
0
X
 
 
16353
Proto-oncogene tyrosine-protein kinase FER
686
500
115
0
X
 
 
16352
AF2094
546
391
91
0
X
 
 
16350
pheromone En-A1
313
167
0
0
X
 
 
16349
Tyrosine-protein kinase ABL2
750
547
145
0
X
 
 
16348
DEAD RINGER-LIKE PROTEIN 1
842
587
134
0
X
 
 
16347
ATC0852
636
465
119
0
X
 
 
16345
permutant P54-55
537
393
104
0
X
 
 
16344
S6wt
541
0
106
0
X
 
 
16343
INSULIN A CHAIN, INSULIN B CHAIN
276
0
0
0
X
 
 
16342
a-synuclein
130
375
130
0
X
 
 
16341
inMIA14-PR
135
416
135
0
X
 
 
16340
calcium-loaded Calbindin D9K P43G
487
386
92
0
X
 
 
16339
LKAMG
558
301
121
0
X
 
 
16338
CG11242
478
373
96
0
X
 
 
16337
Complex of APH with antibiotic tobramycin
217
631
215
0
X
 
 
16336
NMB1076
709
406
129
0
X
 
 
16335
BSU15050
414
306
73
0
X
 
 
16334
nonmyristoylated NCS1
737
502
175
0
X
 
 
16333
LAH4
120
0
0
0
X
 
 
16332
lah4
126
0
0
0
X
 
 
16330
DsbA monomer
158
498
158
0
X
 
 
16329
DsbA monomer
836
672
168
0
X
 
 
16328
single chain polymers
606
315
126
0
X
 
 
16325
lkr136b
416
395
92
0
X
 
 
16323
SLBP30mer
155
0
0
0
X
 
 
16322
CD147
182
356
182
0
X
 
 
16321
UbcH8
362
460
140
0
X
 
 
16320
SSO6904
579
433
96
0
X
 
 
16319
Carnocyclin_A
305
260
64
0
X
 
 
16318
CBP TAZ2/Adenoviral E1A Complex
795
424
131
0
X
 
 
16317
human interleukin-33
872
548
151
0
X
 
 
16316
IntB phage-integrase-like protein
642
505
122
0
X
 
 
16315
putative phage integrase IntS
609
492
124
0
X
 
 
16314
IAPP
178
0
0
0
X
 
 
16313
AR3436A
465
366
86
0
X
 
 
16312
mul_A0064N
702
392
124
0
X
 
 
16311
VEK-30/plasminogen kringle 2 complex
741
523
128
0
X
 
 
16310
apo cL-BABP T91C
364
234
114
0
X
 
 
16309
holo cL-BABP T91C
115
236
116
0
X
 
 
16307
Truncated hemoglobin
734
537
142
0
X
 
 
16306
Truncated hemoglobin
672
492
138
0
X
 
 
16305
NbSyn2 Monomer
595
432
130
0
X
 
 
16304
monomer
122
344
122
0
X
 
 
16303
monomer
133
380
133
0
X
 
 
16302
monomer
133
378
133
0
X
 
 
16301
monomer
128
236
128
0
X
 
 
16300
alpha-synuclein
130
366
130
0
X
 
 
16299
T1 domain tetramer
90
240
90
0
X
 
 
16298
SH1003
687
511
116
0
X
 
 
16297
AIDA-1 SAM domain tandem
615
501
121
0
X
 
 
16296
FCP1 monomer
378
321
86
0
X
 
 
16295
y1fatc
197
119
36
0
X
 
 
16294
Pru p 3 (nsLTP)
270
0
0
0
X
 
 
16293
CA150 FF1+linker
421
251
78
0
X
 
 
16292
2:1 complex
58
0
0
0
 
X
 
16291
2:1 complex
55
0
0
0
 
X
 
16290
1:1 complex
50
0
0
0
 
X
 
16289
d(GCTATAGC)2
48
0
0
7
 
X
 
16288
1:2 complex
49
0
0
0
 
X
 
16287
2:1 complex
54
0
0
0
 
X
 
16286
d(CGAGCTCG)2
46
0
0
7
 
X
 
16285
PDZ protein
574
432
120
0
X
 
 
16284
y1fatc
198
123
36
0
X
 
 
16283
VpR247
652
485
104
0
X
 
 
16282
d(AGAGCTCT)2
48
0
0
7
 
X
 
16281
1:1 complex
42
0
0
0
 
X
 
16280
d(GAGCTC)2
35
0
0
0
 
X
 
16279
Hsp90 middle domain
201
671
201
0
X
 
 
16278
SO2144
943
502
167
0
X
 
 
16277
ATP7A
648
494
122
0
X
 
 
16276
SO2144
997
709
176
0
X
 
 
16275
Apelin-17
128
69
13
0
X
 
 
16274
SLBP
98
0
17
0
X
 
 
16273
OCRL bridges clathrin-mediated membrane
919
674
163
0
X
 
 
16272
VpR247
652
486
104
0
X
 
 
16271
OCRL bridges clathrin-mediated membrane
753
424
131
0
X
 
 
16270
Sortase A-substrate complex
859
636
157
0
X
 
 
16269
n-NafY
408
233
81
0
X
 
 
16268
cannabinoid receptor-2 helix 6
175
0
0
0
X
 
 
16267
tungsten formylmethanofuran dehydrogenase subunit D
805
604
142
0
X
 
 
16266
Pfu RPP29-RPP21 complex
1127
909
204
0
X
 
 
16265
N-terminal domain monomer
188
389
188
0
X
 
 
16264
Glutaredoxin
523
276
89
0
X
 
 
16263
NLRP7 Pyd monomer
595
417
101
0
X
 
 
16262
p68N
452
235
83
0
X
 
 
16261
Microplusin
413
254
99
0
X
 
 
16260
PvFKBD
728
497
127
0
X
 
 
16259
beta7 integrin tail
282
0
50
0
X
 
 
16258
RCL
715
634
146
0
X
 
 
16257
Nogo66 in pH 4.0
164
73
54
0
X
 
 
16256
Drosha
399
244
68
0
X
 
 
16255
Nmul_A0922
613
353
107
0
X
 
 
16253
Rv2377c
264
210
52
0
X
 
 
16252
A13
412
232
70
0
X
 
 
16251
syr103b_protein
679
480
118
0
X
 
 
16250
human intersectin-1
623
352
112
0
X
 
 
16249
NR3 dimer
684
517
148
0
X
 
 
16248
PknB-phosphorylated Rv1827
843
643
176
0
X
 
 
16247
F1Fo ATP synthase
272
210
51
0
X
 
 
16246
Prp24-RRM2
426
256
83
0
X
 
 
16245
IscU monomer
98
0
98
0
X
 
 
16244
U6 snRNP (fragment)
131
0
131
0
X
 
X
16243
Prp24-RRM23
159
0
158
0
X
 
 
16241
Plantaricin J
162
88
27
0
X
 
 
16240
SlyD
732
609
148
0
X
 
 
16239
Plantaricin J
162
80
24
0
X
 
 
16238
VC_A0919
566
437
102
0
X
 
 
16237
OmpATb
1164
579
235
0
X
 
 
16236
Bruno_RRM3+
650
432
117
0
X
 
 
16235
linear kalata B1
140
0
0
0
X
 
 
16233
Eimeria tenella microneme protein 3 mar1a domain
600
481
121
0
X
 
 
16231
Pathogen Recognition Domain from Plodia interpunctella
594
415
110
0
X
 
 
16230
U6 snRNP (small fragment)
544
367
91
0
X
 
X
16229
1H, 13C, and 15N Chemical Shift Assignments for ring1B C terminal domain/ cbx7 CBOX complex
181
157
39
0
X
 
 
16228
ubiquitin
338
323
80
0
X
 
 
16226
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
230
0
0
0
 
X
 
16225
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
231
0
0
20
 
X
 
16223
5'-D(*DCP*DTP*(FAG)P*DA)-3'
46
0
0
0
 
X
 
16222
5'-D(*DCP*DTP*DAP*DTP*(FAG)P*DAP*DTP*DTP*DCP*DA)-3'
220
0
0
0
 
X
 
16221
CBD monomer of MMP2
89
123
43
0
X
 
 
16219
PTK6-SH3
374
256
72
0
X
 
 
16218
apoMb(1-119) fragment
35
38
35
0
X
 
 
16217
apoMb(1-119) fragment in the presence of DnaK-beta
35
38
35
0
X
 
 
16216
ITSN1
629
360
103
0
X
 
 
16215
wt-brazzein
321
221
59
0
X
 
 
16214
Zn finger protein YBIL
497
349
91
0
X
 
 
16213
MESD
1133
599
190
0
X
 
 
16212
5'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'
81
0
0
0
 
X
 
16211
PpiD
570
0
108
0
X
 
 
16210
JARID1A PHD finger 3
315
203
58
0
X
 
 
16209
JARID1A PHD finger 3
267
199
57
0
X
 
 
16208
NmerAHg
349
176
60
0
X
 
 
16207
NmerA
346
173
62
0
X
 
 
16206
RRM DOMAIN OF GW182
498
336
94
0
X
 
 
16205
apo HisJ
579
755
213
0
X
 
 
16204
holo HisJ
557
702
227
0
X
 
 
16203
3,5-dioxohexyl ACP
485
362
92
0
X
 
 
16202
3-oxo-butyl-ACP
483
355
92
0
X
 
 
16201
octanoyl ACP
491
362
92
0
X
 
 
16200
hexanoyl ACP
481
355
91
0
X
 
 
16199
butyryl-ACP
483
361
92
0
X
 
 
16198
Tim23
463
359
90
0
X
 
 
16197
malonyl ACP
478
362
92
0
X
 
 
16196
acetyl Actinorhodin Acyl Carrier
479
355
92
0
X
 
 
16195
AKAP13-PH
1056
818
189
0
X
 
 
16194
hnRNP F/AGGGAU G-tract RNA complex
598
283
114
0
X
 
X
16193
hnRNP F/AGGGAU G-tract RNA complex
586
357
97
0
X
 
X
16192
hnRNP F/AGGGAU G-tract RNA complex
593
258
102
0
X
 
X
16191
Monomer
499
348
100
0
X
 
 
16190
cNTnC and WW7
21
21
0
0
X
 
 
16189
FKBP3-N
436
325
75
0
X
 
 
16188
Rv2175c
802
369
152
0
X
 
 
16187
FP1
189
0
0
0
X
 
 
16186
PSPTO_3016
758
561
124
0
X
 
 
16185
Mouse Prion Protein (121-231)
422
367
135
0
X
 
 
16184
Mouse Prion Protein (121-231)
412
364
135
0
X
 
 
16183
Tammar Wallaby Prion Protein (121-230)
680
473
132
0
X
 
 
16182
PatE prepropeptide
215
0
0
0
X
 
 
16181
EHD1 with FNYESTGPFTAK
685
365
91
0
X
 
 
16180
EHD1/FNYESTNPFTAK complex
689
365
91
0
X
 
 
16179
EHD1 with FNYESTNPFTAK
680
365
91
0
X
 
 
16178
MeVamp-4
160
0
0
0
X
 
 
16177
E73 Homodimer
386
227
69
0
X
 
 
16176
Prp40-FF4
440
249
61
0
X
 
 
16175
CquiOBP1
680
496
120
0
X
 
 
16174
Rv0287-Rv0288 complex
922
487
197
0
X
 
 
16173
p23t
1009
678
191
0
X
 
 
16172
barnase
256
0
0
0
X
 
 
16171
Barnase
257
0
0
0
X
 
 
16170
Barnase
287
0
0
0
X
 
 
16169
Barnase
291
0
0
0
X
 
 
16168
PHOSPHOLEMMAN
396
138
68
0
X
 
 
16167
FXYD4 monomer in micelles
136
123
60
0
X
 
 
16166
HCV (Con1) NS5A-D3
82
257
82
0
X
 
 
16165
HCV (JFH1) NS5A-D2
80
277
80
0
X
 
 
16164
XcpT
621
387
116
0
X
 
 
16163
F0
591
442
118
0
X
 
 
16162
beta1D integrin tail
295
0
60
0
X
 
 
16161
BfR257C
625
329
108
0
X
 
 
16160
MYPT1 1-98 monomer
333
380
92
0
X
 
 
16159
beta1A integrin tail
261
0
51
0
X
 
 
16158