BMRB 1H Chemical Shift Entries
listed by accession number in descending order


Number of entries returned: 9603

  Query grid description

Retrieve entries as a:

Compressed file

Query result listed by accession number in descending order :

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Short hydrophobic peptide, 11mer, SS
Short hydrophobic peptide, 11mer
Short hydrophobic peptide, 11mer
NSsCT-Tfb1PH complex
AIM2 PYD from Mus musculus
Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710b
CCR5-ECL2 helical structure, residues Q186-T195
Peptidyl-prolyl cis-trans isomerase A
SH2-SH3 adapter protein drk
SH2-SH3 adapter protein drk
p300 Taz2-p53 TAD2 Complex
Protegrin-3 (PG3)
hnRNP C RRM in complex with 5'-UUUUC-3' RNA
MbtH-like protein from Mycobacterium marinum
NS1B ED dimer
NS1B ED mutant monomer
Cullin3 - BTB interface
Cullin3 - BTB interface
N-terminal domain of human TIG3
Bud31p protein
Bud31p protein
Endo T5-ZN+2
hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNA
acidic domain of SYNCRIP (hnRNPQ)
transforming growth factor beta induced protein (TGFBIp)
DEFA1, a highly potent antimicrobial peptide from the horse
VG16KRKP, an antimicrobial peptide in SDS
VG16KRKP, an antimicrobial peptide in D8PG micelles
VPg of porcine sapovirus
Clathrin Heavy Chain
zinc finger domain
human TRAP1-NTD
RING Domain of human Promyelocytic Leukemia Protein (PML)
TPMT *1 16-245
EphB2 kinase domain
Abp1p SH3 domain
Acidocin B
53BP1 tandem Tudor domains in complex with a p53K382me2 peptide
53BP1 tandem Tudor domains in complex with a p53K370me2 peptide
MG200 EAGRbox
CaM Tr2C, monomer
Talin-F3 / RIAM N-terminal Peptide complex
NMR structure of the protein YP_193882.1 from Lactobacillus acidophilus NCFM in presence of FMN
VG16KRKP, an antimicrobial peptide in LPS
carboxy-terminal domain of DNTTIP1
Protein Hybrid Beta-Synuclien HC
ligand-free OAA
FBP28 WW2 mutant Y438R DN
FBP28 WW2 mutant Y438R L453A DNDC
FBP28 WW2 mutant Y438R DNDC
FBP28 WW2 mutant W457F
FBP28 WW2 mutant Y446L
FBP28 WW2 , mutation Y438R
Human Small Ubiquitin like Modifier protein-1 (SUMO-1)
lasso peptide streptomonomicin
NP_809137.1 monomer
TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)
eEF1Bdelta CAR domain in TCTP-bound state
eEF1Bdelta CAR domain
SpoVM P9A mutant
Uncharacterized protein
60S pre-ribosome
[GlnB22]-insulin mutant
human insulin
hypothetical protein NP_344732.1 from Streptococcus pneumoniae TIGR4
N-domain of the AAA metalloproteinase Yme1
Human Relaxin-2
FtsH periplasmic N-domain
Human FAAP20 UBZ-Ubiquitin Complex
Human FAAP20 UBZ
human IgG-Fc
PHD domain of Yeast YNG2
amyloid beta
SERA protein peptide analogue 6737
High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1
High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1
protegrin-2 docked to DPC Micelles
peptide 6762
synthetic peptide 36075
1585 Malarial Peptide
analgesic sea anemone peptide APETx2
Peptide of acidic-basic repeat antigen (ABRA) from Plasmodium falciparum
1513 MSP-1 peptide
STARP peptide 20570
putative arsenate reductase from Brucella melitensis
L,D-transpeptidase in complex with a peptidoglycan hexamuropeptide
STARP peptide 20546
malaria short AMA-1 peptide analogue
malaria peptide 1815
YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNA
Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-trans dicarba RgIA
Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-cis dicarba RgIA
Hepatitis C Virus p7
De Novo Designed Peptide that Sequesters Toxic Heavy Metals
Filamin repeat 21 bound to integrin
Non-reducible analogues of alpha-conotoxin RgIA: [2,8]-cis dicarba RgIA
MLL-IBD complex
three-way junction from the VS ribozyme
three-way junction from the VS ribozyme
RRM1 of human LARP6
Doc48S monomer
Decorin Binding Protein A
Decorin Binding Protein A
DMXAA-bound mSTING dimer
human ubiquitin conjugating enzyme Ube2w
Isolated Ring domain
MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1
MLKL N-terminal domain
Kindlin-2 F2
LEDGF/p75 IBD in complex with MLL1 peptide (140-160)
putative phosphoglycolate phosphatase
circumsporozoite protein peptide
left-handed G-quadruplex
tRNApro:MLV Nucleocapsid Protein (1:1) Complex
pf tRNApro:MLV-Nucleocapsid (1:2) Complex
MciZ from Bacillus subtilis
EcMazE homodimer
EcMazE homodimer
MazE-DNA binding
truncated EcMazE
rhodanese domain of YgaP
Putative uncharacterized protein BTH I2711
human EpoR
CSD1-SXL-18-mer msl2 mRNA
PTPN4 PDZ-linker
Rad18-UBZ/ubiquitin complex
High mobility group protein from Plasmodium falciparum 3D7
NESG Target OR459
UBA domain of DNA-damage-inducible 1 protein (Ddi1)
PCP7T holo form
Structure of De novo designed Protein OR457
Nucleocapsid protein p10 and RNA (68-MER)
membrane-active toxin from crab spider Heriaeus melloteei
RNA (68-MER)
Transient Collagen Triple Helix Binding to a Key Metalloproteinase
cChimeraX Ca2+ bound
cChimera Ca2+ bound
bacterial immunoglobulin-like domain form a surface protein of Leptospira
OMPA C-terminal domain
NMR structure of the hypotheical protein Lreu_0056 from Lactobacillus reuteri
NMR structure of the hypothetical protein BVU_0925 from Bacteroides vulgatus ATCC 8482
NMR structure of putative beta-lactamase (NP_372339.1) from Staphylococcus aureus Mu50
Polyglutamine binding peptide 1 (QBP1)
ROQ domain
Cysteine Deleted Protegrin-1 (CDP-1): lr10
Cysteine Deleted Protegrin-1 (CDP-1): rr11
Hypertrophic Cardiomyopathy-Related R502W Mutant
Cysteine Deleted Protegrin-1 (CDP-1): rr14
Phosphotyrosine binding domain
LysM region of the E. coli Intimin periplasmic domain
aggregative adherence fimbriae
WW3 domain of Nedd4L in complex with its HECT domain PY motif
AIP-IV peptide
AIP-II peptide
AIP-III_L7A peptide
AIP-III_DL7 peptide
AIP-III_D4A peptide
MDCSGCSRPG + Zn acidic
MDCSGCSRPG + Zn acidic
MDCSGCSRPG bound to Cu
Chikungunya Virus Fusion Peptide
conotoxin pu14a
conotoxin lt14a
extended upain
alpha-conotoxin ImI Cystathionine 1-3
alpha-conotoxin ImI Cystathionine 2-4
Tryptophan Zipper analogue
MccJ25 RGD
conotoxin qc16a
nociceptin Agonist
Alpha-conotoxin Vc1.2
VK22 in DPC micelles
thromboxane A2 receptor
C-terminal domain of the Gq protein alpha subunit in the presence of thromboxane A2 receptor
Substance P in DMPC/CHAPS/GM1 bicelles
Substance P in DMPC/CHAPS bicelles
Substance P
alpha-conotoxin FI
Gaq-ct only
SecA fragment
15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide)
SecA fragment
conotoxin ImI analogue
Substance P
Pis-1 [PG]
cis Pis-1[NkG]
trans Pis-1[NkG]
REV analogue
rsv analogue
nociceptin analogue
nociceptin analogue
nociceptin analogue
nociceptin Antagonist
Dirhodium complex
complex BK-PGG
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Model Peptide
Myelin Basic Protein
LSEAL-CaMLD complex
KIA7H tetramer
KIA7W tetramer
Insulin A-chain variant peptide
Human Insulin A-chain peptide
Human Obestatin
D-PAKKR monomer
Mu-contoxin KIIIA
Interleukin-8 C-terminal domain
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Apelin 17
Apelin 17
Apelin 17
brome mosaic virus protein 1a
F protein
SIIIA monomer
metastin analog
PFR peptide
PFR peptide
L7P Con-T
sodium channel toxin Hd1a
protein YgaP from Escherichia coli
Kelch domain
N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1
PR domain of FOG-1
NPM-N (Nucleophosmin) pentamer
CnA free
B24G insulin
[AibB8,LysB28,ProB29]-insulin analogue
human HCN2 CNBD in the cAMP-unbound state
BA42 protein
SUMO Dimer in Complex with SIM2-3 from RNF4
Structural basis for binding of Pan3 to Pan2 and its function in mRNA recruitment and deadenylation
N-terminal Domain of Enzyme I
tandem SH3 domain of CAP
Nrd1p CID - Trf4p NIM complex
V domain of RAGE in complex with IOR
cytoplasmic rhodanese domain of the full-length inner membrane protein YgaP
inner membrane protein YgaP
terminal Ig-like domain from Leptospira interrogans LigB
TM domain of LAMP-2A
MBD4 methyl-cytosine binding domain bound to methylated DNA
putative thioredoxin (ECH_0218) in the oxidized state
Dual-phosphorylated human p38 alpha ADP and MK2 334/D peptide bound
Dual-phosphorylated human p38 alpha MK2 334/D peptide bound
Dual-phosphorylated human p38 alpha ADP-bound
peptide ImI1
p38-0P apo
HP24stab derived from the villin headpiece subdomain
DNA dodecamer with A:C mismatch
hIFABP-oleate complex
DNA dodecamer containing the 5-hydroxycytosine
cold shock protein, TaCsp with dT7
cold shock protein, TaCsp
KDM5B PHD1 finger in complex with H3K4me0(1-10aa)
KDM5B PHD1 finger
DNA duplex
HP24wt derived from the villin headpiece subdomain
P22S mutant of N-terminal CS domain of human Shq1
EDB and specific binding aptide
phosphorylated 4E-BP2 monomer
PPIase domain of TbPar42
Thymosin alpha 1
Q4D059, a hypothetical protein from Trypanosoma cruzi
CGACTAGTCG with AIK-18/51-1
Oligonucleotide Model of the MiR-21 Pre-Element
peptoid analogue of maculatin G15 - peptoid trans-Nleu at position 13
a peptoid analogue of maculatin G15 containing cis-Nleu at position 13
transport protein m
a computational designed protein based on structure template 1cy5
YmoB. A modulator of biofilm formation
D-arm of tRNA(Met)
6aJL2 Amyloidogenic Light Chain Protein
AG(7-deaza)G FAPY modified duplex
AGC FAPY modified duplex Major isomer
AGT FAPY Modified duplex
a ribosomal protein
GK cecropin-like peptide
Phosphorylated Mengovirus Leader Protein
Phosphorylated Mengovirus Leader Protein
a peptoid analogue of maculatin G15 in DPC micelles
Mengovirus Leader Protein Bound to Ran GTPase
Mengovirus Leader Protein Bound to Ran GTPase
AGA modified
Unknown protein YP_001712342.1 from Acinetobacter baumannii
GrxS14-BolA2 apo-heterodimer from Arabidopsis thaliana
reduced BolA2 from Arabidopsis thaliana
PA3793 from Pseudomonas aeruginosa
alpha amylase inhibitor peptide aS1 from Allatide scholaris
alpha-amylase inhibitor peptide aS4 from Allatide scholaris
Coronavirus Envelope Proteins-1
RNase 4
ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholate
Ptr ToxB
E. coli Trigger Factor in complex with unfolded PhoA365-471
E. coli Trigger Factor in complex with unfolded PhoA1-150
E. coli Trigger Factor in complex with unfolded PhoA220-310
New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein
antimicrobial peptide LsbB
antimicrobial peptide LsbB
reduced Jaburetox
sortase A from S. aureus in complex with benzo[d]isothiazol-3-one based inhibitor
Solution structure of a TrkAIg2 domain construct for use in drug discovery
Lasso Peptide Caulonodin V
B25-(alpha, beta)-dehydro-phenylalanine insulin
Stf76 from the Sulfolobus islandicus plasmid-virus pSSVx
mutation G159D in troponin C bound to the anchoring region of troponin I
C-domain of troponin C bound to the anchoring region of troponin I
COILED COIL DOMAIN OF Protein phosphatase 1 regulatory subunit 12A
a computational designed protein based on template of human erythrocytic ubiquitin
YSCUCN in a micellar complex with SDS
NMR structure of hypothetical protein ZP_02069618.1 from Bacteroides uniformis ATCC 8492.
hypothetical protein ZP_02064002.1 from Bacteroides ovatus ATCC 8483
PrgK first periplasmic domain
LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalis
6aJL2-R24G Amyloidogenic Light Chain Protein
hinge monomer
Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIH
N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin I
G-triplex truncated-TBA
fourth constant immunoglobulin domain of nurse shark IgNAR
Solution structure of the SGTA N-terminal domain
CPEB1RRM12 in complex with RNA
CPEB4RRM12 in free state
CPEB4RRM12 in complex with RNA
tandem UIMs of wild-type RAP80
E81 deletion mutant from RAP80 tandem UIMs
Heterotrimeric pre-mRNA Retention and Splicing Complex
dimeric transmembrane domain of Toll-like receptor 3
Tetra-O-GalNAc glycosylated mucin sequence from alpha dystroglycan mucin domain
Plectin repeat domain 6
gp41 ectodomain monomer on a DPC micelle
N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1)
Lactodifucotetraose (LDFT) beta anomer
synthetic Mamba-1 peptide
DNA (28-MER)
Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase
Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase
Dimethylarginine Dimethylaminohydrolase
Calcium Bound S100P - V Domain of RAGE complex
second bromodomain of Brd4 with Di-acetylated Twist peptide
C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)
TIA-1 RRM2,3 monomer
trimeric Skp
NLRC5 caspase recruitment domain (CARD)
peptidyl-tRNA hyrolase from Vibrio cholerae
trimeric Skp with bound tOmpA
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
HIFABP Ketorolac complex
GLD-1 KH-QUA2 bound to 5'-CUACUCAUAU-3'
Ig-alpha YE variant Ig-beta construct
Ig-alpha Ig-beta construct
Ig-alpha Ig-beta construct
H83A apo HasAp
Y75A apo HasAp
WT apo HasAp
Yah1 reduced
Yah1 Oxidized
Zn-binding domain of eukaryotic translation initiation factor 3, subunit G
Receiver domain of ethylene receptor ETR1
Transport protein A
Domain-Swapped GLPG
Designed Exendin-4 analogues
native split Npu DnaE intein
CDYL2 chromodomain
extracellular sensor domain of DraK histidine kinase
Neurotoxin II from snake venom Naja Oxiana
Iron-sulfur cluster binding protein from Ehrlichia chaffeensis
dimerization domain of the human polyoma, JC virus agnoprotein
soluble A 17-34 peptide
P33A mutant of non-conventional toxin WTX from Naja kaouthia
m04/gp34 mouse Cytomegalovirus Immunoevasin core domain
preQ1 Class II riboswitch from Streptococcus pneumoniae
novel venom peptide toxin from sample limited terebrid marine snail
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
FHL2 LIM adaptor and its Interaction with Ski
oxidized dimeric form of human defensin 5
Divalent Cations at the Active Site of the Neurospora VS Ribozyme
immune signalling subunit
RRM3 intermediate state
S-linked glycopeptide sublancin 168
Zinc finger-PHD-type 1 domain_number-1
E. coli LpoB
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4
CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44
CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10
p75 transmembrane domain
Dok1 PTB domain monomer
lysine-free (K0) ubiquitin
Ms-NbGRP2 monomer
a3Y monomer
carboxyterminal domain of NusG
I-V kissing-loop interaction of the Neurospora VS ribozyme
SHB modified duplex
RHB Modified duplex
Penicillium Antifungal Protein PAF
CD79b cytosolic domain phosphorylated
CD79b cytosolic domain phosphorylated
human Mcl-1
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
CD79b cytosolic domain denatured
CD79b cytosolic domain
CD79a cytosolic domain phosphorylated
CD79a cytosolic domain phosphorylated
major factor VIII binding region on von Willebrand factor
CD79a cytosolic domain
CD79a cytosolic domain
5-Hydroxytryptamine Receptor 2a and 2c Variants with PSD-95 and SAP997
cytochrome c Y67H
Outer Membrane Protein X from E. coli
Pseudomonas aeruginosa Tps4 two-partner secretion system
CR4/5 domain of medaka telomerase RNA
EF-hand domain from sea urchin polycystin-2
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
Cyanobacterial GAF domain
protein NP_419126.1 from CAULOBACTER CRESCENTUS
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
circular sortase A
GA-79-MBP cs-rosetta structures
PetF monomer
DNA duplex containing N3T-ethylene-N1I
lantibiotic NAI-107
transport protein
Big domain from Leptospira interrogans
Dimethylarginine Dimethylaminohydrolase
basic-helix-loop-helix region of the transcriptional repressor HES-1
Enzymatic cyclisation of kalata B1 using sortase A
p300 Taz2:ETAD1 complex
Protein-RNA Ternary Complex
mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195
C-terminal domain of SRA1p
UBA Domain of Human NBR1
PASTA domain of PonA2
complex of calmodulin with minimal binding domain from HIV-1 matrix protein
dimer of the metal binding domain 1-16 of human amyloid beta-peptide in complex with Zinc
CEH37 Homeodomain
hman EPRS R12 repeats
WHEP repeats
G-quadruplex bound to the bisquinolinium compound Phen-DC3
Truncated EGF-A
Molecular Binding of TFF1 Estrogen Response Element
alpha-conotoxin Vc1.1: [3,16]-trans dicarba Vc1.1
Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495
computational designed dimer based on the engrailed homeodomain structure
Dvl-2 DEP
peptide derived from the membrane proximal external region of HIV-1 gp41
peptide derived from the membrane proximal external region of HIV-1 gp41
peptide derived from the trans-membrane region of HIV-1 gp41
PAP262-270 in SDS micelles
C-terminal domain from A. ventricosus minor ampullate spidroin (MiSp)
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-trans dicarba Vc1.1
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-cis dicarba Vc1.1
FAPP1 PH domain monomer
cactus-derived antimicrobial peptide Ep-AMP1
FRS2a PTB domain with neurotrophin receptor TrkB
Middle domain of Hsp90alpha
circular g-domain analog from the wheat metallothionein Ec-1
C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1
C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11
Domain 2 of E. coli ribosomal protein S1
Blo 1 12 CBD domain
Blo t 19, a minor dust mite allergen from Blomia tropicalis
hFKBP25 monomer
RsmZ(36-44)/RsmE(dimer) 2:1 complex
RsmZ(SL4)/RsmE(dimer) 2:1 complex
RsmZ(SL3)/RsmE(dimer) 2:1 complex
RsmZ(SL2)/RsmE(dimer) 2:1 complex
cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03
RsmZ(SL1)/RsmE(dimer) 2:1 complex
Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39
MyT1 F4F5 - DNA complex
non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complex
NusE (S10) from Thermotoga maritima
mutant dimeric TM domain of VEGFR2 receptor
trimeric mutant TM domain of VEGFR2 receptor
SLED domain of Scml2
Solution structure of the Nt. GR-RBP1 RRM domain
N-terminal domain of Bilbo1 from Trypanosoma brucei
Complex Between BCL-xL and the p53 Core Domain
BCL-xL containing the alpha1-alpha2 disordered loop
BCL-xL in its p53-bound conformation
Dot1L-AF9 complex
homeodomain transcription factor Gbx1
human wild type FAPP1-PH domain
CFP10 Monomer
Human eRF1
WW Domain Strand-Swapped Dimer
WW Domain with Loop 1 Excised
Novel 4/7-Conotoxin LvIA
Ca free domain 6 of villin
cdN dimer
WW domain with polyproline stretch (PP2WW) of HYPB
PP2WW mutant (KPP2WW) of HYPB
SVIP mutation
WW domain of HYPB
Regulatory Domain of Tyrosine Hydroxylase
RDTH dimer
RDTH dimer
Active Site Mutant Pepitdyl Carrier Protein
P130Cas SD
uninhibited ETV6 ETS domain
Sp140 PHD finger cis conformer
Sp140 PHD finger trans conformer
ShK-like immunomodulatory peptide from Ancylostoma caninum
Recombinant CR1 fragment, domains 1-2
Recombinant CR1 fragment, domains 2-3
putative thioredoxin (ECH_0218) in the reduced state from Ehrlichia chaffeensis
ShK-like immunomodulatory peptide from Brugia malayi
BolA-like hypothetical protein RP812
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
Ubiquitin Binding with SH3 domains
murine norovirus CR6 NS1/2 protein
E7 dimer
spermine modified DNA duplex
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
murine norovirus NS1/2 CW3 WT
mammalian tachykinin neuropeptide gamma
murine norovirus NS1/2 D94E mutant
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
Cat r 1
hypothetical protein
bacteriophage transcription regulator complex with p7 peptide
BldD-CTD monomer
mouse RyR2 domain A
RyR2A delta exon 3
Vav1 SH2 domain complex
Nosiheptide in Complex with TipAS
Promothiocin A in Complex with TipAS
C-Ala domain of alanyl-tRNA synthetase
Rrp7 C-terminal Domain
LMO4-LIM2 in complex with DEAF-1 (404-418)
K11-linked Diubiquitin
OmpX within the trimeric chaperone Skp
tOmpA within the tirmeric chaperone Skp
Trimeric Skp with bound tOmpA
trimeric Skp with bound OmpX
trimeric Skp
K11-linked Diubiquitin
Clip-segment of the von Willebrand domain 1 of Crossveinless 2
antiparallel (2+2) G-quadruplex
The structure of the Box CD enzyme reveals regulation of rRNA methylation
EKLF(22-40)/Ubiquitin Complex
Forkhead DNA binding domain of Brugia malayi DAF-16a
FAT10 first domain
human holo-PRL-3 in complex with vanadate
human Polymerase iota UBM1-Ubiquitin Complex
CARMA1/Bcl10/MALT1 Signalosome: Nucleation Induced Filamentous Assembly
stacked dimeric G-quadruplex
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
parallel-stranded G-quadruplex in DNA poly-G stretches
conotoxin muPIIIA-2
conotoxin muPIIIA-1
Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2
hnRNP G RRM in complex with the RNA 5'-AUCAAA-3'
alpha7 nAChR transmembrane domain
IL10 dimer
Calmodulin, C-terminal domain
N2-dG IQ at G3 in NarI sequence
alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosa
Ani s 5 Anisakis simplex allergen
calbindin D9k magnesium bound-form
calbindin D9k calcium bound-form
calbindin D9k Apo-form
Structure of Pex14 in complex with Pex5 LVxEF motif
complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA
region 2 of E. coli sigmaE
Lipid Transfer Protein from Lentil Lens Culinaris
STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains
STIM1 CC1-CC2 homodimer
Val66 BDNF Prodomain
Met66 BDNF Prodomain
acetylated aSyn A53T monomer
acetylated aSyn monomer
aSyn mouse_T53A&N87S monomer
aSyn mouse_N87S monomer
Transmembrane-cytosolic part of Trop2
C-Terminal Domain of AciniformSpidroin
aSyn A53T monomer
Temporin-1 Ta in lipopolysaccharide micelles
HIV-1 Vif SOCS-box with Elongin BC
DUSP16 Monomer
26S proteasome subunit monomer
cerato populin
RasGRP2 EF hands bound to calcium
DNA helicase RecQ
HHARI Catalytic Domain
Saccharomyces cerevisiae Est3 protein
complex between the amyloid beta peptide (1-40) and the polyphenol epsilon-viniferin glucoside
an inhibitor bound dengue NS3 protease
an inhibitor bound dengue NS3 protease
kalata B7
(HhH)2 domain of human FAAP24
ERCC4 domain of human FAAP24
Pin1 WW domain mutant 6-1g
Pin1 WW domain variant 6-1
DNA-binding domain of T. brucei telomeric protein tbTRF
calcium-bound human S100A12
Pin1 WW domain mutant 5-1g
Pin1 WW domain mutant 5-1
NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA
BeF3 Activated Sma0114
Calcium Sensor
lymphocyte receptor NKR-P1A
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
Bovicin HJ50
Dictyostelium discodieum Myosin Light Chain, MlcC
CRABP1 apo
Sigma-1 receptor chaperone domain
W184AM185A mutant of the HIV-1 capsid protein
HIV capsid dimer
Pin1 WW domain
FimH -heptyl-mannose complex
FimH Y48A mutant
FimH Y48A mutant - Heptyl-mannose complex
RRM domain of HUMAN RBM7
PAI subdomain of Sleeping Beauty transposase
SRSF1 RRM2 in complex with the RNA 5'-UGAAGGAC-3'
HisJ and Histidine
Domain 2 from E. coli HisJ
Domain 1 from E. coli HisJ
2c TCR
AhPDF1 from Arabidopsis halleri
Aha1 dimer from Colwellia psychrerythraea
two-domain RNA-binding fragment of Nrd1
PHD Domain from Human SHPRH
2'F-RNA/2'F-ANA chimeric duplex
proteasome related subunit C terminal domain
proteasome related subunit N terminal domain
Yeast Rpn9
sod2 TM IV
Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain
rhodostomin 48ARGDWN-67NPWNG mutant
rhodostomin 48ARGDWN-67NGLYG mutant
rhodostomin P48A/M52W/P53N mutant
Arginine kinase transition state analogue complex
PcCBM36 monomer
Engineered Cystine Knot Protein 2.5D
BAF155 SWIRM domain
RRM2 of Homo sapiens splicing factor, arginine/serine-rich 1
C-terminal structure of (Y81F)-EhCaBP1
alfa-actinin from parasite Entamoeba histolytica
20S-11S proteasome-activator complex
beta-Hairpin Peptidomimetic Antibiotics
Methanothermobacter thermautotrophicus MCM C-terminus
S72-S107 peptide of 18.5 kDa MBP
calmodulin-binding domain of plant calcium-ATPase ACA2
Trp-cage 16b P12W: a Hyperstable Miniprotein
Trp-cage Circular Permutant
Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 1
PTPN11 C-SH2 bound
PTPN11 C-SH2 free
calmodulin-binding domain of plant calcium-ATPase ACA8
C-terminal domain of translation initiation factor IF-3
HdeA homodimer
cerebral dopamine neurotrophic factor (CDNF)
J-domain of human DnaJA1
p7 channel of Hepatitis C virus, genotype 5a
Amelogenin in SDS
Hedgehog Autoprocessing Domain
CbpAN from Streptococcus pneumoniae
holo YqcA
apo YqcA
actinobacterial transcription factor RbpA
actinobacterial transcription factor RbpA
APC/C_CDH1-EMI1: multimodal mechanism of E3 ligase shutdown
RING domain of E3 ubiquitin ligase Doa10
vertebrate toxin from the badge huntsman spider
Dynorphin A, L5S
ED Complex
BRPF1 momomer
antimicrobial peptide Tk-Amp-X2
B2705-b2m-pGR complex
B2705-b2m-pLMP2 complex
B2705-b2m-TIS complex
B2705-b2m-pVIPR complex
B2709-b2m-pGR complex
B2709-b2m-pLMP2 complex
Domain 11:IGF2 complex
B2709-b2m-TIS complex
B2709-b2m-pVIPR complex
EH domain of EHD3 in presence of Ca2+
human restriction factor APOBEC3A
Phl p 5a
M-2 Branch Mini-M Conotoxins
Enterocin 7B
human beta-2 microglobulin
Enterocin 7A
adenylate kinase with ADP
adenylate kinase with ADP
adenylate kinase with ADP
adenylate kinase with ADP
adenylate kinase with ADP
C-terminal RV0431
Solution structure of human ribosomal protein P1.P2 heterodimer
SPI-2 inhibitor
2A proteinase from a common cold agent, human rhinovirus RV-C02, strain W12
fibrillin e2cb1
USP28 monomer
Solution structure of latherin
Solution structure of the FimH adhesin carbohydrate-binding domain
IsdB N1
human apoptotic protein tBid
FimA wt
Calmodulin IQ motif complex
Solution structure of chicken Engrailed 2 homeodomain
Phosphatase domain of PTPN5
BID-BAK complex
Protein A binding by an engineered Affibody molecule
Frataxin like monomer
2'-5' AG1 lariat forming ribozyme
domain 5 from Azotobacter vinelandii Intron 5
complex of cytochrome P450cam and its electron donor putidaredoxin
h-prune C-terminal domain
Calmodulin/a-syn peptide complex
G-rich VEGF aptamer with LNA modifications
third RNA Recognition Motif (RRM) of U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
SH3 domain of human RAS GAP 1
rubredoxin type protein from Mycobacterium ulcerans
single G-bulge in a conserved regulatory region of the HEV genome
RNA polymerase binding protein A (RbpA)
E. coli ribosomela decoding site with apramycin
Bulges in G-quadruplexes
Galphai3 bound to GDP
putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegans
RRM domain of the hypothetical protein
hypothetical protein BT_0846
MinC N-terminal monomer
Core Domain (10-76) of the Feline Calicivirus VPg protein
Core Domain (11-85) of the Murine Norovirus VPg protein
Allatide O4 conformation 2
Human S100B and Basic Fibroblast Growth Factor (FGF2) Interaction
C-terminus of the minichromosome maintenance protein MCM
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
NC inhibitor 3 complex
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
Ph1500: a homohexameric protein centered on a 12-bladed beta-propeller
Phosphate-bound TpbA
Ca-containing EF-hand protein
Unmodified Helix 69
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
WW3*-aENaC PY peptide complex
S55A mutant of UVI31+
Marine Sponge-Derived Asteropsin E
Novel Alpha4/6-Conotoxin TxIC
Integrin L Transmembrane Domain
MYB-like DNA binding domain of KNL-2 from C. Elegans
N-terminal domain of pneumococcal PhtD protein with bound Zn(II)
alpha-1 integrin I-domain in complex with GLOGEN triple helical peptide
LFA-1 I-Domain
C-terminal AbrB
African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA
Binary complex of African Swine Fever Virus Pol X with MgdGTP
T638E/S657E V5 domain of Protein Kinase C alpha, DPV
V5 domain of Protein Kinase C alpha
T638E/S657E V5 domain of Protein Kinase C alpha
V5 domain of Protein Kinase C alpha
[L-HisB24] insulin analogue at pH 8.0
PmrAn dimer
[L-HisB24] insulin analogue at pH 1.9
Entamoeba histolytica HP1 chromodomain
Full-length cytochrome b5 with heme B
BRCT domain of yeast REV1
NMR structure of the catalytic domain from E. faecium L,D-transpeptidase acylated by ertapenem
NMR solution structure of the AVR3a11 from Phytophthora Capsici
Human programmed cell death 1 receptor
Duplex DNA
RRM2 domain of the protein RBM10 from homo sapiens
two domain PPIase SlpA from Escherichia coli
major G-quadruplex
C-terminal domain of the protein HCFC1
NMR structure of the catalytic domain from E. faecium L,D-transpeptidase
Doc monomer
LMO4-DEAF-1 tethered complex
NMR structure of the glycosylated conotoxin CcTx from Conus consors
N-terminal MAP1B LC
d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma
d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1
helix II template boundary element from Tetrahymena telomerase RNA
Tetrahymena telomerase RNA stem IV terminal loop
CD3g cytosolic domain
EGFR transmembrane - juxtamembrane (TM-JM) segment
hypothetical protein lmo0427
TICAM-1 TIR domain
TICAM-2 TIR domain
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
SP-B C-terminal (residues 59-80) peptide
Solution structure of the Hs. PSIP1 PWWP domain
CaBP4 polypeptide
[Aba5,14]BTD-2, cyclic peptide
ING4 PHD mutant N214D
Lewisx-sp8 acetate
ID3 stem
chaperone in type III secretion system
dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)
Human S100A6 (C3S) with V domain of Receptor for Advanced Glycation End products (RAGE)
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
Antiamoebin I
Biosynthetic engineered B28K-B29P human insulin monomer
Biosynthetic engineered B28K-B29P human insulin monomer
GtYybT PAS Homodimer
Human S100A6 C3S
HIV-1 Rev ARM peptide (residues T34-R50)
HIV-1 Rev ARM single polypeptide chain
Haloferax volcanii HVO_2177 protein
stacked G-quadruplex formed by human TERRA sequence
complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4
Antitoxin PaaA2
monomeric sugarcane canecystatin
ID3 stem loop of domain 1 in the ai5gamma group II intron
VHH 18
dodecamer duplex
SH3 domain of DOCK180
ALPS-23 peptide in SDS micelles
TIA-1 protein
holocytochrome c
C-terminal CFTR peptide and extended PDZ2 domain from NHERF1
C-terminal CFTR peptide and extended PDZ1 domain from NHERF1
extended PDZ1 domain from NHERF1
trans-membrane domain of the NS2A
human S100A14
human PHF1 in complex with H3K36me3
SP-B C-terminal residues 59-80
Nterminal domain of splicing factor 1
ErbB1 (EGFR, HER1)
MHV N-linker peptide
OmpX in DPC micelles
OmpX in phopspholipid nanodiscs
Amylin monomer
module 2 from the E1 domain of C. elegans APL-1
BCL-xL in complex with PUMA BH3 peptide
Kunitz-type neurotoxin LmKKT-1a
staphylococcal nuclease E43S mutant
Erbin PDZ S47
Erbin PDZ WT
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
Hordeum vulgare glycine rich- RNA binding protein 1
omp synthase
omp synthase
TatA oligomer
TatA T22P
NS2(32-57) GBVB protein
NS2(2-32) GBVB protein
PI-AnmTX Ugr 9a-1
RRM1 monomer
Phf19 links methylated lysine 36 of histone H3 to regulation of Polycomb activity
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
YLTA IkappaBalpha
CPAP IkappaBalpha
First Catalytic Cysteine Half-domain
theta-defensin HTD-2 (retrocyclin 2)
WT IkappaBalpha
Mdm2 (6-125) with Pip-1
biofilm matrix promoter AbbA from B. subtilis
Ligase 10C
Grb2 C-terminal SH3 domain
Fibroblast Growth Factor Recoptor
complex of ubiquitin and CD2-associated protein
Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptide
beta 2 integrin tail
alpha 4 integrin tail
HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serine
b-flap domain of RNA polymerase (B. subtilis)
recombinant brazzein
Structure of Co-substituted microcrystalline SOD using PCS and PRE restraints by solid-state NMR
TamA POTRA domain I
influenza A virus S31N mutant (19-49) in presence of drug M2WJ332
Antimicrobial Peptide Human Defensin 5
Siglec5 CRD
RNA BINDING PROTEIN Solution structure of the third KH domain of KSRP in complex with the G-rich target sequence.
UNC-60B from Caenorhabditis elegans
XIAP(RING)-binding domain of XAF1
rmodN-ACSL complex
KIX domain complex (3)
KIX domain complex
Exocrine gland-secreting peptide 4
tpr1 domain
gp78 RING bound to Ube2g2:G2BR
E coli adenylate kinase
E coli adenylate kinase: E170A
Chimeric Peptide of HBD2 and HBD3
E coli adenylate kinase: wild type
RING domain in ubiquitin ligase gp78
potential acylphosphatase from Giardia lamblia
complex between the Sgt2 homodimerization domain and the Get5 UBL domain
Sgt2 homodimerization domain
dUTPase homotrimer
dUTPase homotrimer
The third member of the eIF4E family represses gene expression via a novel mode of recognition of the methyl-7 guanosine cap mo
peptide epsilon(103-120)
peptide a2N(1-17) from Mus musculus V-ATPase
Internal Loop 5'GAGU/3'UGAG
Transmembrane Arced Helix (ArcH)
Single-chain Insulin
Bacterial Intein-Like domain from Clostridium thermocellum
alpha sub-domain
RelA-TAD/CBP-TAZ1 complex
APPTM dimer
APPTM V44M dimer
PawS Derived Peptide 7 (PDP-7)
PawS Derived Peptide 5 (PDP-5)
PawS Derived Peptide 4 (PDP-4)
PawS derived peptide 11 (PDP-11)
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
human -defensins 1 and 6
small molecule-influenza RNA complex
N-80 ALR reduced
N-80 ALR
H-RasT35S mutant protein in complex with Kobe2601
VILIP-3 monomer
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
N-terminal domain of a plant Grx
mutant (T170E) second CARD of human RIG-I
second CARD of human RIG-I
La-type RNA-binding domain
RRM domain
Menk in DMPC SUV
BAD-1 repeat loop
G8A mutant of the influenza hemagglutinin fusion peptide
Myo10 anti-CC
Eph receptor
GGBP - Glucose
anti-CRISPR protein Acr30-35
Solution structure of CCP modules 10-11 of complement factor H
soluble domain of MmpS4
LytTR domain
Eosinophil Cationic Protein
RNA Duplex Containing a 2'-O-Pivaloyloxymethyl Modification
MRH domain
S. aureus pepA1 NMR structure
MHV nsp3a momoner
Griffithsin (GRFT)
gp78CUE/K48-Ub2 complex
gp78CUE/K48-Ub2 complex
gp78CUE bound to ubiquitin
gp78 CUE domain
Methylated Histone Complex
Connexin45 Carboxyl Terminal Domain
Connexin45 Carboxyl Terminal Domain
Griffithsin (GRFT)
variant XI LipA
wild-type Lipase A
Ca-bound Phl p 7
hemi-Mg-bound Phl p 7
apo-Phl p 7
zinc finger AFV1p06 protein
S114A mutant of UVI31+
Ca2+-bound CaBP7 N-terminal doman
complex between Ca-Calmodulin and skeletal muscle myosin light chain kinase
ZirS C-terminal Domain
TM4-Cx43CT monomer
C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497)
Helix-35 Stem-loop from E. coli 23S rRNA
tandem zinc finger domain of Stc1
C85M_S100A1 dimer
Cytosolic Tails of aXb2 Integrin
GPVI peptide mimetic
KB1[GHRW; 23-28]
Ribonuclease III
Ribonuclease III in complex with RNA (32-MER)
RNA Aptamer for B. anthracis Ribosomal Protein S8
alpha tubulin 404-451
beta tubulin 394-445
PICK1 PDZ domain fused to the C10 DAT ligand
Vta1-Vps60 complex
S72-S107 peptide of 18.5kDa murine MBP
Retro Trp-cage peptide
LC3B OPTN-LIR Ptot complex structure
RNA (37-MER)
recombinant tamapin
Cu(I),Zn(II) superoxide dismutase
beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrin
beta2 carbohydrate module of AMP-activated protein kinase
Tg Micronemal Protein 5
RNA (49-MER)
Smurf2 WW3 domain in complex with a Smad7 derived peptide
NEDD4L WW2 domain in complex with a Smad7 derived peptide
Smurf1 WW2 domain in complex with a Smad7 derived peptide
YAP WW1 in complex with a Smad7 derived peptide
YAP WW2 in complex with a Smad7 derived peptide
autoinhibitory domain of human AMP-activated protein kinase catalytic subunit
YdbC:dT19G1 complex
Th205-316 dimer
TM0026 monomer
DsbB C41S
SANT2 domain of NCoR2
Th255-316 dimer
TDRD3 complex
Oxydizied Sulfiredoxin C106V
Reduced Sulfiredoxin
Tb 1-C-Grx1 monomer
major ampullate spidroin 1 N-terminal domain
pwwp domain of TFIIS2-1
L-PGDS/U-46619 complex
Wild-type FAS1-4
N0 domain of Neisseria meningitidis Pilus assembly protein PilQ
HIRAN domain
Synthetic cyclic oligonucleotide
NIPP1 1-143
yeast Tah1 in complex with the Hsp90 C-terminal tail
Apoform of Hahellin
yeast Tah1
R. rickettsii cold shock-like protein
Analog of the fragment 197-221 of 1- adrenoreceptor
BRD4 second bromodomain with NF-kB-K310ac peptide
gpFI C-terminal domain
C-terminal domain of Tetrahymena telomerase protein p65
C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)
mouse Rev1 CTD in complex with the RIR of Pol Kappa
mouse Rev1 C-terminal domain
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
2'F-ANA and ANA self-complementary duplex
human prion protein
S100A11 dimer
eiavCA monomer
B2 domain of Neisseria meningitidis Pilus assembly protein PilQ
ubiquitin homology of mouse BAG-1
human C-type lectin domain family 4 member D
phosphoprotein enriched in astrocytes 15A
putative protein disulfide isomerase
third transmembrane domain from the human copper transport 1
second transmembrane domain from human copper transport 1
first transmembrane domain from human copper transport 1
Target Recognition Domain of Zoocin A
UIM-SH3 monomer
ubiqutin-like protein from Trypanosoma bucei
WNK1 Autoinhibitory Domain
nanocrystalline DsbA
uncharacterized thioredoxin-like protein BVU_1432
EIC dimer
R3H domain from human Smubp-2 in complex with 2'-deoxyguanosine-5'-monophosphate
thiol:disulfide interchange protein
HP1 CSDalpha(109-185)
IIA(chb)-HPr complex
EB1 C-terminal domain
Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptide
dimeric Acanthaporin
ADF like UNC-60A Protein
Kelch domain of mouse Keap1
EB1 CH domain
NP_390037.1 from Bacillus subtilis
anti-fungal defensin DEF4 (MTR_8g070770)
Get5_UBL domain
Sgt2_NT homodimer
trypsin inhibitor BWI-2c
phosphorylated CRKL
Escherichia coli Porins
atypical SH3 domain of DOCK180
Ni(II)-bound NmtR homedimer
TAR RNA binding protein 2 (19-228)
calcium-bound CaM C-terminal domain in a complex
PhoRadA intein
sugarcane cystatin
C-terminal domain of the MgtC protein
A domain of talin
FliGn homodimer
A2POBEC2 1-224
A2POBEC2 41-224
calcium-bound CaM N-terminal domain in a complex
Solution NMR structure of asteropusin A from marine sponge Asteropus sp.
K60A mutant of Atox1
Granulocyte colony-stimulating factor A37G
Granulocyte colony-stimulating factor A30G
Granulocyte colony-stimulating factor A29G
Granulocyte colony-stimulating factor
Ninjurin1 monomer
YmgD dimer
human CEB25 minisatellite G-quadruplex
FKBP12 from Aedes aegypti
PrgI needle
N-terminal domain of human CDNF
DNA Polymerase beta uncomplexed
Dengue Virus NS2B/NS3 in complex with Aprotinin
monomeric phospholamban (C36A, C41F, C46A)
MbtH-like protein
P1 endolysin Lyz
porcine pepsin
porcine pepsin
complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15
alpha-synuclein fibrils
Mutant of the sub-genomic promoter from Brome Mosaic Virus
P1-CheY/P2 complex
S100A1 homodimer
S100A1 dimer
complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2
TpbA monomer
acyl-carrier protein from Rickettsia prowazekii
Lotus domains 2 and 3
Conotoxin analogue [D-Ala2]BuIIIB
Conotoxin analogue [D-Ala2]BuIIIB
Mu-contoxin BuIIIB
HasR N-terminal periplasmic signaling domain
NIPP1 monomer
angiogenin monomer
proteinase inhibitor
optn 550
Get5 carboxyl domain from A. fumigatus
Get5 carboxyl domain from S. cerevisiae
VHS-UIM monomer
Vav2 and Arap3
GspC-HR of typeII secretion system
E60A mutant AGR2
AGR2 residues 41-175
cytosolic region of human VIMP
cytosolic region of human VIMP
atTic-hip/hop domain (Residue 310-371)
Ca-bound S100A4 in complex with non-muscle myosin IIA
Enterohaemorrhagic E. coli (EHEC)
N-terminal domain (6-74) of human ZBP1 protein
Neurolin Ig2
YqcA from Escherichia coli
PHD zinc finger
novel conotoxin im23a from Conus imperialis
MDR 769 homodimer
monomeric Pstrx2
D. radiodurans RecQ
Photoactive Yellow Protein
CdnL N-terminal domain
C-terminal Domain (537-610) of Human Heat Shock Protein 70
human LL-23
allergenic beta parvalbumin
T7 transcription factor Gp2-E. coli RNAp jaw domain complex
C-terminal RAGE (ctRAGE)
a major allergen from dust mite
Cysteine Deleted Analog of Tachyplesin-1
rhesus SPRY domain
AF4-Af9 fusion
transmembrane domains of the a4b2 nAChR
Post-translational S-nitrosylation
Post-translational S-nitrosylation
Calmodulin C-lobe bound with ER alpha peptide
THP type 1 alpha 1 collagen fragment (772-786)
Calmodulin N-lobe bound with ER alpha peptide
amyloid precursor protein's transmembrane domain
UNAC Tetraloops
myb-like1 domain of hDMP1
RNA-binding subunit of the TRAMP complex
eight-stranded (beta/alpha)-barrel
Insect Defensin Lucifensin from Lucilia sericata
EDC3-LSm domain
Solution structure ensemble of the two N-terminal apple domains (residues 58-231) of Toxoplasma gondii microneme protein 4
UNAC Tetraloops
UNAC Tetraloops
UNAC Tetraloops
CaM bound to NOS peptides
CaM bound to NOS peptides
guanylyl cyclase activating protein-1, GCAP1
hUBR2 ubr-box
Cyclo-TC1 Trp-cage
Cx43 C-terminal domain bound to tubulin
Mg2+ bound alpha1 I-domain
Apo alpha1 I-domain
Myristoylated Polyproline Type II Helix
N-terminal domain of human TIG3
Molecular system
Molecular system
Molecular system
Molecular system
Structural and functional analysis of the DEAF-1 and BS69 MYND domains
Cd(II) form of Desulforedoxin
HIV-1 PR Homodimer
HIV-1 PR Homodimer
UUP protein C-terminal domain
Mesobuthus {alpha}-scorpion toxins affecting sodium channels
cyclic gomesin
C-CaM/PEP-19 complex
C-CaM/Ca complex
C-CaM/PEP-19 complex
Zn(II) form of Desulforedoxin
PPARgamma LBD + MRL20
PPARgamma LBD + MRL24
PPARgamma LBD + rosigliazone
PAT Pyk2 and Paxillin LD motif
onconase FLG variant
N-terminal domain of HPV16 E6 oncoprotein
PDGFR-TM dimer
HIV-1 PR Homodimer
Rhodostomin G50L mutant
putative oxidoreductase from Ehrlichia chaffeensis
Bubr1N Blinkin complex
human HOIL-1L
(C9S, C14S)-leucocin A
NMR Structure of protoporphyrin-IX bound murine p22HBP
C5 protein monomer
GlbN holoprotein
Dihydrofolate reductase from Moritella profunda
TauF4 Fragment
Complex of hDlg and E6
a protein from Haloferax volcanii
GATase subunit (monomer) of GMP Synthetase
AIDA1 PTB domain
monophosphorylated (747pY) beta3 integrin
biphosphorylated (747pY, 759pY) beta3 integrin
monophosphorylated (747pY) beta3 integrin
putative thiol-disulfide oxidoreductase
CP12 protein
defensin Lc-def from germinated lentil seeds
GAAA tetraloop monomer
Tfg1 C-terminal domain
third SH3 domain of R85FL
Acidic Scorpion Potassium Channel Toxins
CCL2 (+carbohydrate)
CylR2 homodimer
CylR2 homodimer
CCL2 (free)
Polyserine Tract of Apis mellifera Vitellogenin, residues 358-392
alpha anomeric lesion
holo-acyl carrier protein monomer
Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNA
C-CaM apo form
yeast protein
RNA (32-MER)
Novel Toxin from De Venom of the Scorpion Tityus
Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat
Mucin Glycoprotein Recognition
MUC2_Mucin_Domain_Peptide, SUGAR (2-MER)
MUC2_Mucin_Domain_Peptide, SUGAR (3-MER)
MUC2 Mucin Domain Peptide
Myosin Binding Protein-C Motif
CTD monomer
Staphylococcus aureus IsdH linker domain
RNA (37-MER)
RNA (37-MER)
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
beta phosphoglucomutase in a ternary complex with glucose-6-phosphate and trifluoroberyllate
beta phosphoglucomutase inhibited with trifluoroberyllate
Molecular Level Interaction of the Human Synaptotagmin I C2B domain with Inositol Hexaphosphate
shPrP, Thiamine
C2 Domain
Human C30S/C59S-Cox17 mutant
IsdH-N2N3 monomer
FKBP-type peptidyl-prolyl cis-trans isomerase
DNA Containing an Aristolactam II-dA Lesion
NMR structure of the UHRF1 PHD domain
R2 of histone H3 tail by UHRF1 PHD finger
AHSA1-like protein AHA_2358
Structure of PHD domain of UHRF1 in complex with H3 peptide
Ca2+/CaM L-selectin peptide complex
single polypeptide chain
chicken AvBD2-K31A mutant
Chicken AvBD2 defensin
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct
PhyRSL-NepR complex
DamX SPOR domain
Human prion protein with E219K protective polymorphism
the intermediate IIIb of the TdPI-short
Solution structure of the N-terminal domain of the Shigella type III secretion protein MxiG
chimeric Af1503 HAMP- EnvZ DHp homodimer; A219F variant
chimeric Af1503 HAMP- EnvZ DHp homodimer
Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)
CaM-OLFp complex
cl-BABP/SS complex
p53 N-terminus
murine prion protein (residues 121-232)
murine prion protein (residues 121-232)
human prion protein (residues 121-230)
human prion protein (residues 121-230)
Reg I-alpha monomer
HR3111A dimer
N-terminal domain of E3 ligase HECW2
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
IGFBP-2 N-terminal domain
ETV6 R458
ETV6 Q436
AHSA1-like protein CHU_1110
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
C-Terminal domain of Ler
conotoxin pc16a
KSR1 CA1-CA1a domain
KSR1 CA1-CA1a domain
esophageal cancer-related gene 2
NMR Structure of Mouse ApoAI(1-216)
human prion protein mutant HuPrP(90-231, M129, V210I)
SMN-Gemin2 complex
DsbA and DsbB
SRSF2_RRM/RNA complex
protein complex for DNA replication
Monomeric HP67 H41F
Extracellular domain of GLIC
RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptide
Dynein Light Chain 8
carnitine palmitoyltransferase 1A
Uracil-DNA glycosylase inhibitor p56
PARP-1 BRCT domain
RNA (31-MER)
short chain LaIT 1
NTL9 V3AI4A double mutant
RNA (27-MER)
Trp-Cage mini-protein with D-amino acid
ZiaAn sub mutant
TgMIC4-apple5 monomer
synuclein tetramer
ORF57 103-120
ORF57 56-140
LmrA-NBD ADP complex
stapled peptide SP6
stapled peptide SP1
stapled peptide SP2
Human Telomeric DNA
SAP30 and PAH3
S108C mutant of Phosphomannomutase/Phosphoglucomutase
myosin VI lever arm extension
YtvA Dimer
EL222 monomer
Ebolavirus Fusion Loop pH 7.0
Ebolavirus Fusion Loop pH 5.5
short Grx domain
Grx domain
FUS/TLS RRM domain
Cytidine Repressor DNA-Binding Domain
Syk/Vav complex
Nbp2_SH3 and Ste20_peptide
Act2-EF34-palladin complex
Microvirin:mannobiose complex
Model of human U2AF65 tandem RRM1 and RRM2 domains with eight-site uridine binding
Solution structure of the closed conformation of human U2AF65 tandem RRM1 and RRM2 domains
Solution structure of the EF-hand domain of Human Polycystin 2
D2 domain of human fibroblast growth factor receptor 4
WALP19-P10 complex
S4-3 voltage sensor peptide
plasmodium falciparum ribosomal lateral stalk
RfaH carboxyterminal domain
GppNHp-bound H-RasT35S mutant protein
RBBP1 tudor domain
RBBP1 chromobarrel domain
Phosphomannomutase/Phosphoglucomutase Monomer
MLV readthrough pseudoknot
Solution Structure of PilP from Pseudomonas aeruginosa
TM1_TM2 in TFE:water
Anabaena Sensory Rhodopsin Transducer with DNA
Anabaena Sensory Rhodopsin Transducer with F-tails
Anabaena sensory rhodopsin transducer
thurincin H
Solution structure of the skeletal muscle and neuronal voltage gated sodium channel antagonist mu-conotoxin CnIIIC
Myc G-quadruplex
H/ACA RNP protein Nhp2p
H/ACA RNP protein Nhp2p-S82W mutant
Siderocalin Q83
C domain of Rv0899
yeast RNase III dsRBD complex with a non-canonical RNA substrate
Anticodon Stem-loop (coi6y)
i6A37 tyrASL
TASL3 (monomer)
TASL2 (monomer)
Unmodified Glycyl-tRNA(UCC) anticodon stem-loop
Glycyl-tRNA(UCC)1B anticodon stem-loop
glycyl-tRNA anticodon stem-loops
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
Unliganded Bovine Neurophysin
FZL4 (monomer)
FZL2 (monomer)
CHR/DPC micelle
human ribosomal protein P1/P2 heterodimer
yPEPmin of Rsa1p
tandem UBA of USP13
acyl CoA binding protein
Ph SAM linker
cI-BABP-GCDA complex
mvWFA2 monomer
Hevein-type Antifungal Peptide with a Unique 10-Cysteine Motif
first domain of human PIN1 in complex with a human Smad3 derived peptide( resi 173-186)
second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 (res 178-189) derived peptide
first domain of human Smurf1 in complex with a human Smad1 derived peptide
human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptide
human Smurf1 in complex with a phosphorylated human Smad1 derived peptide
human Yap in complex with a human Smad1 derived peptide
first WW domain of human YAP in complex with a human Smad1 doubly-phosphorilated derived peptide
second WW domain from human YAP in complex with a human Smad1 derived peptide
Human minimembrane protein OST4
Complex of SUMO1 with RanBP2 M-IR2 SIM peptide
DNA/RNA hybrid
SpaI monomer
Sex Peptide from Drosophila melanogaster
circular proteins in legumes
AHSA1-like protein RHE_CH02687 (1-152)
Nedd4LW3/smad3 complex
Extracellular domain of mouse Notch-1 EGF12
Extracellular domain of mouse Notch-1 EGF12
Norwalk virus protease
Unmodified ASL_Tyr
Starch Binding Domain 2 of beta/alpha-amylase
Starch Binding Domain 1 of beta/alpha-amylase
Anticodon Stem-loop of Bacillus subtilis tRNATYR
INAD PDZ5 complexed with Kon-tiki peptide
LZ-cJun dimer
Immunity protein 7
primase CTD
LZ-GCN4 dimer
protein ligand complex
DJ-1 protein
N-terminal Domain of the Ribosomal Protein L9
human muscle acylphosphatase polypeptide
RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide
Thuricin CD
Zinc knuckle in PRDM4
MoCVNH-LysM module from the rice blast fungus Magnaporthe oryzae protein MGG_03307
Thuricin CD
C-terminal domain of Prp24
FF domain L24A mutant
monomer of ICL3 (residues A221 to K345) 5-HT1A
mSin3A PAH2-Pf1 SID1 Complex
Mouse MFG-E8 C2 Domain
Structural basis of p63a SAM domain mutants involved in AEC syndrome
CD147 Ig0 C66M Dimer
Chimera monomer
NS5A fragment (191-369) monomer
Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)
THAP domain of human THAP11
TrJPMP22-TDPC micellar complex
PMP22-TDPC micellar complex
protein YP_546394.1
Solution structure of human ubiquitin conjugating enzyme Rad6b
trans-Resveratrol in complex with the cardiac regulatory protein Troponin C
Integrin beta3
Myristoylated msrA
outer membrane protein RcsF
Arenicin-2 dimer
AIDA1 PTB domain
p21 kinase inhibitory domain bound to Cdk2 and Cyclin A
island 1 protein gp6
Integrin 1
Control DNA duplex
Cidofovir DNA duplex
Pab PolII intein
cytochrome P450cam
GABARAPL-1 and NBR1-LIR complex
triazole-linked DNA duplex
PTH-HA20 solution
A protein from fission yeast
Zn bound FCS domain of hPh1
amidated IAPP
CBP bromodomain with small molecule of HBS
complex of CBP bromodomain with small molucule J28
protein from Haloferax volcanii
Complex SrcKD with Imatinib
Crimean Congo Hemorrhagic Fever Virus Cytoplasmic Gn Tail
Raf-1 kinase inhibitor protein
putative surface protein
Sans CEN2
hPCNA trimer complexed with C-terminal region of p21
hPCNA trimer complexed with C-terminal region of p21
ADF/Cofilin from Trypanosoma brucei
pdz domain
protein BVU 1572(27-141)
cytotoxic T-lymphocyte antigen_2 (CTLA-2) like protein, crammer
ASHH2 a CW domain
PTB Domain of TENC1 in complex with the peptide of DLC1
calcium-calmodulin complexes
PsbQ protein
high calcium androcam
Taf14 YEATS domain
rG4 substituted Drew Dickerson dodecamer
CHD4-PHD2/H3K9me3 complex
GIP in Bicellular media
Engrailed 2
Mus81-winged helix domain
W protein of bacteriophage lambda
W protein of bacteriophage lambda
T box riboswitch Specifier domain and GA motif
C-terminal dsRBD of the Fission Yeast DICER
Nonphosphorylated Peptide Recognizing Domain
Tah1 complex with C-terminus of Hsp90 (MEEVD)
coronavirus stem-loop 2
HIV-1 Capsid in complex with stapled peptide Inhibitor
NLRP12 PYD monomer
human liver fatty acid binding protein
human liver fatty acid binding protein
PHD finger (PHD1) from CHD4 (Mi2b)
rat epididymal lipocalin 12
TgADF Monomer
putative thioredoxin
unbound Alk5 ectodomain
human PIWI-like 1 PAZ domain with ssRNA (5'-pUGACA)
Human PIWI-like 1 PAZ domain
complex of GPS2 53-90 and SMRT 167-207
Brd3 in complex with GATA-1 C-tail
uncharacterized thiredoxin-like protein
Fusion protein
calmodulin IQ motif complex
Small archaeal modifier protein 1 from Methanosarcina acetivorans
Calcium bound S100A16
APO S100A16
UCHL1 S18Y variant
Pineapple Cystatin
VirB7-Xac2622 monomer
GIP/Glutaminase L peptide complex
GIP apo
AMA1 inhibitor peptide
SARS-CoV main protease N-terminal domain
Thioredoxin C
Influenza HA fusion peptide(G13A)
UBA+Ub complex
Sco proteins
PlyG (E.C.
ArsD homodimer
trHbN cyanomet
Mouse prion protein (121-231) with the mutation Y169A
Rap1 BRCT domain
Ste2p TM1-TM3 (G31-R161)
VHD monomer
Cox17y monomer reduced
ubiquitin-like small archaeal modifier protein
Acyl carrier protein
Tandem SH2 domains of Spt6
little finger domain of Dpo4
UHRF1 Tandem Tudor Domains/Histone H3 complex
Cu-binding protein
UBA monomer
SEVI precursor peptide PAP
Complex Rpp30
visual arrestin
BT_0084 lipoprotein
SP_0782 homodimer
Mouse prion protein
Nrd1 CID
RNase A C-dimer
PARP-1 Finger 2
PARP-1 Finger 1
FKBP in complex with 1-{[(4-methylphenyl)thio]acetyl}piperidine
Pitx2 homeodomain
Pitx2 homeodomain R24H
HYL1 second dsRBD
MBD2/p66-alpha complex
Drosophila Frataxin monomer
Domain 11 of the IGF2R
amino-terminal UBA domain of OTUD7A
N-terminal domain of fibroin 1
25-mer DNA oligomer
Domain 11 mutant
IGF-II in complex with the mutant form of human domain 11
Heparanase 158-417
apo DHFR
PKC-delta C1A
PKC-delta C1B
Family D Sortase
Human Insulin Mutant
Human Insulin Mutant
calcium-sensitizer, dfbp-o, in complex with troponin C and the switch region of troponin I
DNA-binding protein SATB1
SH3 monomer
P6.1 hairpin
Prion with Y169A, Y225A, Y226A mutation
ASIP(93-126, P103A, P105A, P111A, Q115Y, S124Y)
mouse prion protein with mutation F175A
Prion with Y169G mutation
Shc-PTB complex with Integrin beta3
tRNALeu monomer