BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB 1H Chemical Shift Entries

listed by accession number in descending order


Number of entries returned: 10441

Query grid description

Retrieve entries as a: Compressed file


Query result listed by accession number in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Protein
DNA
RNA
34015
myristoylated M-PMV matrix protein mutant
577
374
100
0
X
 
 
34010
Inner membrane protein YgaP
516
310
0
0
X
 
 
34009
Inner membrane protein YgaP
558
303
110
0
X
 
 
34002
Insulin-like growth factor II
397
279
73
0
X
 
 
34001
Insulin-like growth factor II
396
184
71
0
X
 
 
34000
Insulin-like growth factor II
386
174
72
0
X
 
 
30136
Flagellar protein FliT
190
194
103
0
X
 
 
30134
Flagellar protein FliT,Flagellar hook-associated protein 2
570
528
139
0
X
 
 
30127
Flagellar protein FliT,Flagellum-specific ATP synthase (E.C.3.6.3.14)
294
500
139
0
X
 
 
30118
Endothelial PAS domain-containing protein 1
695
505
122
0
X
 
 
30098
Helicase-like transcription factor (E.C.3.6.4.-,6.3.2.-)
670
487
129
0
X
 
 
30097
Protein DDI1 homolog 2
578
405
103
0
X
 
 
30094
Coat protein
441
377
101
0
X
 
 
30090
Envelope glycoprotein gp160
37
75
37
0
X
 
 
30089
Hge-scorpine
260
0
0
0
X
 
 
30088
Immunoglobulin G-binding protein G
294
224
65
0
X
 
 
30079
Uncharacterized protein
498
413
91
0
X
 
 
30078
Guanine nucleotide-binding protein G(i) subunit alpha-1
243
0
243
0
X
 
 
30077
Guanine nucleotide-binding protein G(i) subunit alpha-1
244
0
244
0
X
 
 
30074
Dynein light chain Tctex-type 1
1356
808
268
0
X
 
 
30070
Uncharacterized protein
360
246
68
0
X
 
 
30065
Voltage-dependent anion-selective channel protein 1
253
466
252
0
X
 
 
30053
DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')
156
0
0
16
 
X
 
30051
Cyclic peptide mimetic of HIV-1 Tat/RNA Complex
375
162
0
0
X
 
X
30050
Serine/threonine-protein kinase B-raf (E.C.2.7.11.1)
497
378
76
0
X
 
 
30049
Cyclic peptide mimetic of Tat/RNA Complex
375
162
0
0
X
 
X
30048
Serine/threonine-protein kinase B-raf (E.C.2.7.11.1)
497
378
76
0
X
 
 
30046
Cyclic peptide mimetic of HIV-1 Tat/RNA Complex
375
162
0
0
X
 
X
30044
DNA Dodecamer with 8-oxoguanine at 10th Position
162
0
0
14
 
X
 
30038
DNA
162
0
0
14
 
X
 
30034
Uncharacterized protein
553
439
115
0
X
 
 
30033
Hge-scorpine
287
139
50
0
X
 
 
30032
Zinc finger and BTB domain-containing protein 17
148
65
22
0
X
 
 
30031
E3 ubiquitin-protein ligase Midline-1 (E.C.6.3.2.-)
313
231
52
0
X
 
 
30025
SdrG
667
499
121
0
X
 
 
30024
RaCI2
339
203
62
0
X
 
 
30023
Sensory transduction regulatory protein
672
502
123
0
X
 
 
30021
Mitochondrial Calcium Uniporter
136
385
136
0
X
 
 
30020
beta-galactosidase 1
653
444
114
0
X
 
 
30019
E3 ubiquitin-protein ligase UHRF1 (E.C.6.3.2.-), Spacer
822
421
152
0
X
 
 
30012
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')
218
0
0
0
 
X
 
30010
Myc box-dependent-interacting protein 1, CHIKV nsP3 peptide
610
334
105
0
X
 
 
30008
Nucleocapsid protein p7
42
125
42
0
X
 
 
30007
Type I modular polyketide synthase
432
348
93
0
X
 
 
30006
Type I modular polyketide synthase
541
315
92
0
X
 
 
30005
Protein phosphatase 1 regulatory subunit 12A
298
206
50
0
X
 
 
30004
CREB-binding protein,Cellular tumor antigen p53 (E.C.2.3.1.48)
945
509
153
0
X
 
 
30003
CREB-binding protein,Cellular tumor antigen p53 (E.C.2.3.1.48)
724
385
122
0
X
 
 
30002
Cellular tumor antigen p53,CREB-binding protein (E.C.2.3.1.48)
988
531
162
0
X
 
 
30000
DE NOVO DESIGNED PROTEIN OR258
810
594
130
0
X
 
 
26854
AsLOV2
827
644
166
0
X
 
 
26851
COMT monomer, Sinefungin, DNC, Mg
204
639
204
0
X
 
 
26848
COMT monomer, SAM, DNC, Mg
205
641
205
0
X
 
 
26839
MLV-CAH
230
203
69
0
X
 
 
26825
Lunasin monomer
261
124
51
0
X
 
 
26824
Lunasin monomer
261
126
51
0
X
 
 
26821
apoTrpR
349
218
90
0
X
 
 
26820
Lunasin monomer 16-43
153
81
29
0
X
 
 
26808
Egr-1 DNA complex
512
366
109
0
X
X
 
26807
The Egr-1 zinc-finger protein
519
368
110
0
X
 
 
26801
NFU1
1154
680
196
0
X
 
 
26782
USP7 - ICP0 complex
187
563
187
0
X
 
 
26779
Cdc25B monomer
143
467
143
0
X
 
 
26767
NSD1
212
612
212
0
X
 
 
26764
hTRF1
102
139
50
0
X
 
 
26763
STARD6-testosterone complex
201
608
201
0
X
 
 
26761
XlnB2
146
446
147
0
X
 
 
26759
NSD2 C16
189
584
189
0
X
 
 
26755
NHE1
113
381
113
0
X
 
 
26752
hSSB1
116
350
116
0
X
 
 
26751
2B4 TCR
282
827
282
0
X
 
 
26745
SrtC1 monomer
339
310
192
0
X
 
 
26744
TrmK
222
660
222
0
X
 
 
26739
SipD
114
114
0
0
X
 
 
26735
LARA3
111
359
111
0
X
 
 
26733
p38g monomer
267
769
281
0
X
 
 
26732
p38g monomer
116
116
0
0
X
 
 
26731
Paired domain of Pax5 in complex with DNA
135
424
135
0
X
X
 
26730
Paired domain of Pax5
137
431
137
0
X
 
 
26727
Doublecortin C-terminal domain monomer
109
417
108
0
X
 
 
26726
Extracellular Adherence Protein
92
181
92
0
X
 
 
26725
MtRpsA_S4
559
355
87
0
X
 
 
26724
Tcb2-C
569
457
106
0
X
 
 
26723
Tcb2-C
567
450
101
0
X
 
 
26721
RXFP1(1-72)
132
198
66
0
X
 
 
26718
Domain Swapped HIV RNase H
122
239
122
0
X
 
 
26717
NcLPMO9C
963
860
220
0
X
 
 
26715
beta-endorphin
26
146
32
0
X
 
 
26709
linear diubiquitin
132
255
132
0
X
 
 
26708
NEMO
75
148
75
0
X
 
 
26705
SAMSAM monomer
114
360
114
0
X
 
 
26701
T-STAR KH
101
0
101
0
X
 
 
26700
Sam68 STAR
144
0
144
0
X
 
 
26698
rNedd4 WW3 Domain
212
133
38
0
X
 
 
26695
S1-DHFR-N
131
407
131
0
X
 
 
26694
S1-DHFR-NT
142
440
142
0
X
 
 
26693
DHFR-apo
97
276
97
0
X
 
 
26691
ZnF-Bcd1
261
186
43
0
X
 
 
26688
Mg2+ -bound myrGCAP1 (V77E) mutant
188
283
113
0
X
 
 
26687
CaM34-iNOS
740
419
144
0
X
 
 
26686
CaM34
135
0
135
0
X
 
 
26685
CaM12
144
0
144
0
X
 
 
26684
Chica
67
199
67
0
X
 
 
26683
CaM34
138
0
138
0
X
 
 
26682
CaM12
143
0
143
0
X
 
 
26681
CaM1234
601
266
142
0
X
 
 
26680
pEAbeta(3-42)
140
112
41
0
X
 
 
26679
pEAbeta(3-42)
40
79
40
0
X
 
 
26678
Amyloid-beta(1-42)
41
83
41
0
X
 
 
26675
GVIIJ_SSEA
165
0
0
0
X
 
 
26674
GVIIJ[C24S]
180
63
31
0
X
 
 
26672
FUS LC monomer
145
408
145
0
X
 
 
26664
UBXD1-N
178
196
91
0
X
 
 
26663
c-Myc
71
236
83
0
X
 
 
26662
c-Myc
71
235
76
0
X
 
 
26655
emerin 67-170
96
202
96
0
X
 
 
26654
emerin 67-170
95
304
95
0
X
 
 
26653
Nogo-A-Delta20
237
352
170
0
X
 
 
26652
Akt_PHD in complex with Calmodulin
85
92
85
0
X
 
 
26651
Akt_PHD
97
197
97
0
X
 
 
26650
SIX3_HD
377
260
62
0
X
 
 
26646
mini H2-Ld
170
506
170
0
X
 
 
26645
single polypeptide chain
105
308
104
0
X
 
 
26644
N-terminal 24-kDa fragment of Escherichia coli topoisomerase IV ParE subunit
203
610
203
0
X
 
 
26643
GBD-Nck
136
264
88
0
X
 
 
26642
Envoplakin PRD
184
562
184
0
X
 
 
26641
MurD monomer
371
0
371
0
X
 
 
26640
alpha B crystallin
56
138
55
0
X
 
 
26639
CBP-ID4
160
604
205
0
X
 
 
26638
apolipophorin III
698
625
185
0
X
 
 
26637
dengue virus NS4B N-terminal 125 amino acids
445
505
119
0
X
 
 
26636
ERD14
142
0
142
0
X
 
 
26635
human K-Ras4B-GDP
171
0
171
0
X
 
 
26632
Protein G Domain Beta-1 Sequence H
57
167
57
0
X
 
 
26631
MATH-PUC
130
375
128
0
X
 
 
26630
Protein G Domain Beta-1 Wild-Type
56
165
56
0
X
 
 
26629
MATH
134
270
127
0
X
 
 
26628
HuR RRM1-2
153
0
153
0
X
 
 
26627
CaM+Fas47-83
267
376
179
0
X
 
 
26626
CaM+Fas
148
276
146
0
X
 
 
26625
ASAP1 PH domain
99
1
97
0
X
 
 
26618
ORP
503
476
114
0
X
 
 
26617
NaK tetramer
79
199
77
0
X
 
 
26616
CBP-ID4
160
607
205
0
X
 
 
26615
SUR2A NBD1-MgATP complex
173
490
173
0
X
 
 
26611
active domains of the type II topoisomerases
223
648
223
0
X
 
 
26610
active domains of the type II topoisomerases
223
652
223
0
X
 
 
26609
active domains of the type II topoisomerases
204
612
204
0
X
 
 
26608
active domains of the type II topoisomerases
204
607
204
0
X
 
 
26607
NmFic
172
524
172
0
X
 
 
26604
ubiquitin (microcrystal)
66
203
66
0
X
 
 
26603
Microtubule-associated protein light chain 3C (LC3C)
800
593
131
0
X
 
 
26602
D10alphabetaTCR, pTalpha/D10beta
192
554
192
0
X
 
 
26601
N30alphabetaTCR, pTalpha/N30beta
207
606
207
0
X
 
 
26600
N15alphabetaTCR, pTalpha/N15beta
198
580
198
0
X
 
 
26599
THAP11 coiled-coil dimer
66
130
66
0
X
 
 
26598
DNA gyrase B subunit
218
636
218
0
X
 
 
26597
DNA gyrase B
218
629
218
0
X
 
 
26595
hTRF1-DnaK complex
42
120
42
0
X
 
 
26594
hTRF1 monomer
48
141
48
0
X
 
 
26593
Obscurin Ig59
442
356
94
0
X
 
 
26592
LcrG
58
121
58
0
X
 
 
26591
PcrG9-76
74
145
75
0
X
 
 
26590
cTEM-19m
229
419
229
0
X
 
 
26589
yAAC3
256
669
256
0
X
 
 
26586
TEM-1(M68L-M69T)
247
458
248
0
X
 
 
26582
Cyanobacterialchrome GAF domain
740
610
156
0
X
 
 
26580
nuclear egress subunit M50 from murine cytomegalovirus
774
632
162
0
X
 
 
26577
Cyanobacteriochrome GAF6012g4
301
463
157
0
X
 
 
26576
Medin
44
0
44
0
X
 
 
26575
Gli3_1_90
86
256
86
0
X
 
 
26574
GAT
88
271
88
0
X
 
 
26573
TBD
47
142
47
0
X
 
 
26571
EhCaBP6
545
306
144
0
X
 
 
26570
SOD1 monomer
673
546
136
0
X
 
 
26569
TCR 3c8m t55a, TCR alpha
200
624
200
0
X
 
 
26568
The structure of the SOLE element of oskar mRNA
251
213
38
30
 
 
X
26565
Notch1 transmembrane segement
46
137
46
0
X
 
 
26564
DbhS C31S monomer
331
868
276
0
X
 
 
26562
major mite allergen Der p 23
193
139
41
0
X
 
 
26558
FNIII7-8
852
682
170
0
X
 
 
26553
Solution Structure of the Smarc Domain
706
333
110
0
X
 
 
26552
PfIMP1 monomer
916
693
145
0
X
 
 
26551
p73 DNA binding domain
175
573
175
0
X
 
 
26549
NS5A D2D3
433
689
235
0
X
 
 
26547
PLK4-PB3/STIL-CC
70
154
70
0
X
 
 
26546
SpaO-OrgB
151
432
151
0
X
 
 
26543
SpaO
150
446
150
0
X
 
 
26541
FimH-CRD
191
510
173
0
X
 
 
26538
Short hydrophobic peptide, 11mer, SS
21
0
0
0
X
 
 
26537
Short hydrophobic peptide, 11mer
20
0
0
0
X
 
 
26536
Short hydrophobic peptide, 11mer
20
0
0
0
X
 
 
26535
PmrA-DNA complex
299
502
200
0
X
 
 
26534
FtsXECL1 monomer
646
540
122
0
X
 
 
26532
PmrA dimer
295
684
193
0
X
 
 
26531
EDN
120
210
122
0
X
 
 
26530
SPM
570
460
154
0
X
 
 
26529
W_plusUB
85
227
85
0
X
 
 
26528
Molecule_Uw
136
367
136
0
X
 
 
26527
Molecule_1
85
230
85
0
X
 
 
26526
Molecule_2
135
367
135
0
X
 
 
26518
putative transfer protein TraH from Gram-positive conjugative plasmid pIP501
793
563
147
0
X
 
 
26517
TAM DOMAIN OF TIP5_BAZ2A
694
392
107
0
X
 
 
26509
PHF6-ePHD1
624
464
127
0
X
 
 
26058
d58CI dimer
117
246
117
0
X
 
 
26053
MapZ_SY
561
426
113
0
X
 
 
26052
MapZ_QG
697
557
137
0
X
 
 
26043
BRD4 ET domain with NSD3_3 peptide
561
321
81
0
X
 
 
26042
BRD4 ET with LANA
584
350
96
0
X
 
 
26041
BRD4 ET with NSD3_1
565
329
82
0
X
 
 
26026
PriC DNA replication restart protein
634
568
134
0
X
 
 
26025
Q4DY78 monomer
618
451
106
0
X
 
 
26012
N-terminal Domain of Human Cdc37
477
501
117
0
X
 
 
26008
N-L-idosylated Pin1 WW Domain
217
0
0
0
X
 
 
26007
N-Xylosylated Pin1 WW Domain
217
0
0
0
X
 
 
26006
N-Galactosylated Pin1 WW Domain
218
0
0
0
X
 
 
26005
N-Allosylated Pin1 WW Domain
215
0
0
0
X
 
 
26004
U5-scytotoxin-Sth1a
189
146
38
0
X
 
 
26003
U3-scytotoxin-Sth1h
183
143
32
0
X
 
 
26002
U3-scytotoxin-Sth1a
178
135
32
0
X
 
 
26000
delta-J-delta-K domain of EMCV IRES
274
0
0
0
 
 
X
25999
St domain of EMCV IRES
188
164
0
0
 
 
X
25998
K domain of EMCV IRES
176
167
0
0
 
 
X
25997
J domain of EMCV IRES
154
143
0
0
 
 
X
25996
J-K region of EMCV IRES
90
0
0
0
 
 
X
25995
human Rpn13 Pru domain
778
581
149
0
X
 
 
25993
Human gammaC-crystallin
879
664
179
0
X
 
 
25985
A3B CTD
960
481
199
0
X
 
 
25976
fungal hydrophobin
458
379
91
0
X
 
 
25975
Geobacillus stearothermophilus IF2 G3-subdomain
537
402
110
0
X
 
 
25973
V26A mutant of Ubiquitin at pH 2.0
321
302
71
0
X
 
 
25972
V26A mutant of Ubiquitin at pH 6.0
320
305
70
0
X
 
 
25970
Acidic domain of SYNCRIP (24-140)
643
478
127
0
X
 
 
25969
minor DNA-uptake pilin ComP
677
513
115
0
X
 
 
25968
Mal d 1.0101
770
614
152
0
X
 
 
25966
C-terminal extramembrane domain of SH protein
158
112
29
0
X
 
 
25965
N-terminal extramembrane domain of SH protein
80
56
15
0
X
 
 
25963
PDP-10
94
0
0
0
X
 
 
25962
PDP-9
95
0
0
0
X
 
 
25961
Q388A3 PDZ domain
442
276
102
0
X
 
 
25956
Solution structure of oxidised and zinc-bound RsrA
581
327
92
0
X
 
 
25955
Solution structure of reduced and zinc-bound RsrA
506
289
93
0
X
 
 
25954
Bt1.8 peptide
80
0
0
0
X
 
 
25952
RSL
103
249
96
0
X
 
 
25951
RSLfuc
110
255
96
0
X
 
 
25950
RSLman
112
256
97
0
X
 
 
25949
Ex-4[1-27]/pl14a
216
0
0
0
X
 
 
25948
Ex-4[1-16]/pl14a
155
0
0
0
X
 
 
25947
KYE28A in lipopolysachharide
147
0
0
0
X
 
 
25946
KYE28 and lipopolysachharide
173
0
0
0
X
 
 
25945
Toca1
665
458
109
0
X
 
 
25943
NLRP3 PYD
518
289
84
0
X
 
 
25939
K2 lobe of double-knot toxin
180
0
0
0
X
 
 
25934
Nizp1-C2HR zinc finger
241
0
37
0
X
 
 
25933
NSD1-PHD_5-C5HCH tandem domain
525
366
93
0
X
 
 
25932
P441A Mutant of the Cytokine Receptor Common Subunit beta
42
119
41
0
X
 
 
25931
Cytokine Receptor Common Subunit beta
43
119
42
0
X
 
 
25930
Transmembrane domain of human Fas/CD95 death receptor
24
51
24
0
X
 
 
25929
Transmembrane domain of mouse Fas/CD95 death receptor
25
52
25
0
X
 
 
25927
Curli secretion specificity factor CsgE W48A/F79A mutant
611
470
116
0
X
 
 
25925
rv3053c from Mycobacterium tuberculosis in the oxidized state
461
360
88
0
X
 
 
25922
K1
238
0
0
0
X
 
 
25921
IF7
258
226
74
0
X
 
 
25920
Integrin alphaIIb-beta3(A711P) Transmembrane Complex
116
219
76
0
X
 
 
25917
ProTx-II
196
84
33
0
X
 
 
25915
Photoswitchable G-quadruplex
48
34
0
0
 
X
 
25914
RNF126 N-terminal zinc finger domain in complex with BAG6 Ubiquitin-like domain
718
548
136
0
X
 
 
25913
RNF126 N-terminal zinc finger domain
227
183
38
0
X
 
 
25912
IscA
146
270
91
0
X
 
 
25908
oxidized human cytochrome c
676
465
105
0
X
 
 
25907
reduced human cytochrome c
694
466
108
0
X
 
 
25901
SUMO-2 bound to phosphorylated RAP80 SIM
81
230
81
0
X
 
 
25900
NRAS Isoform 5
116
0
0
0
X
 
 
25899
RockCC
814
620
148
0
X
 
 
25897
Holo F2 TnC
318
462
153
0
X
 
 
25896
Apo F2 TnC
154
441
154
0
X
 
 
25895
PARP-1_WGR_free
449
238
119
0
X
 
 
25894
PARP-1_F1F2F3-WGR-DNA_complex
444
0
444
0
X
X
 
25893
PARP-1_F3
924
545
162
0
X
 
 
25892
PARP-1_F1F2F3
332
350
332
0
X
 
 
25891
PARP-1_F1F2F3-DNA_complex
335
348
335
0
X
X
 
25890
DNA free
340
0
0
0
 
X
 
25889
F1F2 free
191
0
191
0
X
 
 
25888
F1F2-DNA complex
576
272
200
0
X
X
 
25885
RBM24
594
450
104
0
X
 
 
25883
DD homodimer
475
284
96
0
X
 
 
25882
dsDNA-lomaiviticin A complex
153
0
0
0
 
X
 
25881
yeast Hit1 protein zinc finger
251
190
47
0
X
 
 
25880
N-terminus F2 TnC
86
252
86
0
X
 
 
25879
C-terminus F2 TnC
68
190
68
0
X
 
 
25878
N-terminus F2 TnC
429
259
87
0
X
 
 
25877
cecropin P1 with LPS
183
100
29
0
X
 
 
25875
C-terminus F2 TnC
304
205
66
0
X
 
 
25873
RSK1 peptide
44
0
44
0
X
 
 
25871
Apo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1
852
504
152
0
X
 
 
25870
Holo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1
868
517
151
0
X
 
 
25869
LptE
819
587
162
0
X
 
 
25868
DA05R1
593
425
94
0
X
 
 
25867
PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRES
29
0
29
0
 
 
X
25866
rNedd4 WW2 Domain
207
118
35
0
X
 
 
25865
rNedd4 WW2 Domain-Cx43CT Peptide Complex
242
119
35
0
X
 
 
25864
rNedd4 WW1 Domain
222
128
36
0
X
 
 
25863
ACT RTX domain
132
380
132
0
X
 
 
25861
DHFR-N
133
382
133
0
X
 
 
25860
DHFR
144
435
144
0
X
 
 
25859
complex between MMP-12 and synthetic triple-helical collagen
799
635
165
0
X
 
 
25858
Lacticin Q
315
0
0
0
X
 
 
25857
Aureocin A53
339
0
0
0
X
 
 
25851
TRIM24 PHD-Bromo
312
327
154
0
X
 
 
25850
DA05
613
440
104
0
X
 
 
25849
Gbx1[E17R,R52E]
394
298
76
0
X
 
 
25840
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
51
0
0
0
 
X
 
25839
YgaU
881
658
160
0
X
 
 
25838
A3CT monomer
119
153
79
0
X
 
 
25837
chromodomain 3 (CD3) of cpSRP43
342
242
67
0
X
 
 
25833
p75NTR DD:RIP2 CARD
1159
675
225
0
X
 
 
25831
complex of microRNA 20b pre-element with Rbfox RRM
746
566
115
0
X
 
X
25830
Lipid Transfer Protein From Pea Pisum Sativum
509
379
96
0
X
 
 
25829
p75NTR DD:RhoGDI
1403
878
257
0
X
 
 
25828
RIP2 CARD
648
372
122
0
X
 
 
25827
metal-binding domain 1 of ATP7B
335
293
72
0
X
 
 
25826
microRNA 20b pre-element
175
153
0
0
 
 
X
25825
UBL protein
563
404
98
0
X
 
 
25820
Peptide PG-990
78
0
0
0
X
 
 
25819
Leptospiral LigA4 Big Domain
372
233
100
0
X
 
 
25818
transmembrane domain of human nicastrin in DPC micelles
192
120
45
0
X
 
 
25817
transmembrane domain of human nicastrin in SDS micelles
202
128
44
0
X
 
 
25816
PDZ domain
440
276
102
0
X
 
 
25814
Peptide PG-990 in DPC micelles
72
0
0
0
X
 
 
25813
Peptide PG-989
72
0
0
0
X
 
 
25811
core of the U4/U6 di-snRNA
30
5
25
0
 
 
X
25810
N-domain of troponin C bound to the switch region of troponin I and the covalent levosimendan analog i9
541
352
116
0
X
 
 
25807
B3 domain of protein G
218
132
55
0
X
 
 
25806
prolactin receptor transmembrane domain
176
161
37
0
X
 
 
25805
cyclic nucleotide-binding homology domain of hERG channel
687
508
125
0
X
 
 
25804
muO-conotoxin MfVIA
187
98
22
0
X
 
 
25803
UBL domain of the yeast DNA damage-inducible protein homolog 1
500
360
89
0
X
 
 
25802
CD302
832
627
151
0
X
 
 
25801
UBL domain of the human DNA damage-inducible protein homolog 2
471
332
83
0
X
 
 
25799
human I-type lectin domain-glycan complex
912
623
154
0
X
 
 
25798
human Siglec-8
870
620
158
0
X
 
 
25797
cardiac troponin C
460
281
91
0
X
 
 
25793
RNA-Binding domain of non-structural protein 1 from the 1918 H1N1 influenza virus
384
311
71
0
X
 
 
25791
kinase in complex with its regulatory protein
859
611
155
0
X
 
 
25790
polyQ regulatory protein
442
289
83
0
X
 
 
25789
CmPI-II, a serin protease inhibitor
236
170
55
0
X
 
 
25788
Influenza-A M2
80
250
59
0
X
 
 
25787
salicylate-loaded ArCP from yersiniabactin synthetase
481
345
81
0
X
 
 
25786
holo ArCP from yersiniabactin synthetase
484
371
81
0
X
 
 
25785
CssA5 (middle region) of CssA thermometer
204
32
18
0
 
 
X
25784
CssA Thermometer from Neisseria meningitidis
287
31
26
0
 
 
X
25783
Astexin3
131
73
0
0
X
 
 
25782
Lasso peptide Astexin2-dC4
106
59
0
0
X
 
 
25781
CssA3 (top stem) of CssA thermometer
231
67
14
0
 
 
X
25780
CssA4 (bottom stem) of CssA thermometer
215
76
17
0
 
 
X
25777
Tetrahymena telomerase RNA pseudoknot
184
80
0
0
 
 
X
25776
Outer Membrane Protein G P92A mutant
155
488
155
0
X
 
 
25773
Trappin-2
556
401
95
0
X
 
 
25772
Elafin
334
0
0
0
X
 
 
25771
Cementoin
224
0
0
0
X
 
 
25769
frog skin-derived peptide Esculentin-1a[Esc(1-21)NH2]
96
0
0
0
X
 
 
25768
Outer Membrane Protein G from Pseudomonas aeruginosa
181
558
181
0
X
 
 
25766
Zmp1
1140
804
221
0
X
 
 
25765
2-stranded parallel beta-sheet
101
0
0
0
X
 
 
25764
2-stranded parallel beta-sheet
108
0
0
0
X
 
 
25763
MbtH-like protein from Mycobacterium avium
268
235
62
0
X
 
 
25762
Pleiotrophin
540
533
127
0
X
 
 
25761
PC07372D
585
355
107
0
X
 
 
25760
GNPTAB
973
679
179
0
X
 
 
25758
de-novo toxin Hui1
179
49
31
0
X
 
 
25757
calmodulin-connexin36
657
596
152
0
X
 
 
25756
Src catalytic domain
179
540
179
0
X
 
 
25755
non-sweet mutant (ins18RI19) of sweet protein Brazzein
327
159
59
0
X
 
 
25754
LASSO peptide Astexin1
136
73
0
0
X
 
 
25753
sweeter mutant (D40K) of sweet protein Brazzein
321
156
57
0
X
 
 
25751
VG16KRKP_DIMER
92
0
0
0
X
 
 
25750
CIN85 CC-domain trimer
221
277
79
0
X
 
 
25749
C4VG16KRKP
91
0
0
0
X
 
 
25748
ddFLN5+110
204
271
122
0
X
 
 
25746
DNA G-quadruplex
114
0
0
0
 
X
 
25745
N-terminal domain of the metalloprotease PrtV from Vibrio cholerae
449
357
79
0
X
 
 
25744
RpfC
380
227
72
0
X
 
 
25742
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
176
104
25
0
X
 
 
25740
C-terminal domain of Cdc37 cochaperone
495
351
86
0
X
 
 
25736
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
175
114
24
0
X
 
 
25735
The selective autophagy receptor TAX1BP1 is required for autophagy-dependent capture of cytosolic Salmonella typhimurium
402
179
63
0
X
 
 
25734
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
345
174
49
0
X
 
 
25732
PetP
453
347
83
0
X
 
 
25731
phosphoenolpyruvate-Enzyme I complex from the bacterial hosphotransferase system
95
0
95
0
X
 
 
25730
H-Ras G12V
160
482
160
0
X
 
 
25729
EGFR transmembrane and juxtamembrane domains
327
246
57
0
X
 
 
25726
R4 peptide
57
0
0
0
X
 
 
25725
cystein-rich peptide jS1
151
0
0
0
X
 
 
25722
KIAA0323 binding preference for NEDD8
153
0
50
0
X
 
 
25720
Regnase-1 C-terminal domain
350
268
58
0
X
 
 
25719
Regnase-1 Zinc finger domain
195
111
26
0
X
 
 
25718
Regnase-1 N-terminal domain
278
214
50
0
X
 
 
25717
PltL-pyrrolyl
570
313
90
0
X
 
 
25716
pyoluteorin type II pep-tidyl carrier protein PltL, holo form
567
402
92
0
X
 
 
25715
HLA-B2709_TIS
252
767
252
0
X
 
 
25714
HLA-B2705_pVIPR
247
719
247
0
X
 
 
25713
HLA-B2709_pVIPR
255
758
255
0
X
 
 
25712
dehydroascorbate reductase 3A from Populus trichocarpa
925
542
207
0
X
 
 
25711
HLA-B2705_TIS
241
251
241
0
X
 
 
25709
Ub S65E in complex with parkin R0RBR
38
38
0
0
X
 
 
25708
Ub S65E
74
45
74
0
X
 
 
25707
Ub in complex with parkin R0RBR
45
45
0
0
X
 
 
25706
VirA VirFG fusion
422
321
80
0
X
 
 
25704
lasso peptide chaxapeptin
99
79
16
0
X
 
 
25703
oxidized form of thioredoxin 1 from Sacharomyces cerevisiae
530
421
101
0
X
 
 
25702
reduced form of thioredoxin 1 from Sacharomyces cerevisiae
485
380
102
0
X
 
 
25700
R. palustris CsgH
492
399
99
0
X
 
 
25699
N-terminal membrane-anchoring region of the glycosyltransferase WaaG
193
84
0
0
X
 
 
25698
hCFTR NBD1 deltaRI F508del
185
375
186
0
X
 
 
25697
hCFTR NBD1 deltaRI I539T
218
581
206
0
X
 
 
25696
hCFTR NBD1 deltaRI
201
585
201
0
X
 
 
25694
CXCL12-CXCR4
661
452
110
0
X
 
 
25693
xcL1
337
257
62
0
X
 
 
25692
OVIS ARIES PRP
716
0
148
0
X
 
 
25691
kallikrein inhibitor SPINK6
237
0
55
0
X
 
 
25690
eukaryotic elongation factor 1B monomer
773
579
137
0
X
 
 
25688
Acyl Carrier Protein monomer
425
229
78
0
X
 
 
25686
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
209
0
0
0
 
X
 
25685
Transmembrane Electron Transporter CcdA
158
451
156
0
X
 
 
25684
LIPID DROPLET ANCHORING PEPTIDE OF CGI-58
177
125
37
0
X
 
 
25683
T456Y
214
0
0
0
X
 
 
25682
T456D
208
0
0
0
X
 
 
25681
E454Y
171
25
4
0
X
 
 
25680
L453W
207
0
0
0
X
 
 
25679
L453E
170
30
0
0
X
 
 
25678
L453D
204
0
0
0
X
 
 
25677
CBX8 in complex with AF9
452
406
88
0
X
 
 
25676
NS4A_mut
41
134
41
0
X
 
 
25675
N-TERMINAL DOMAIN OF TDP-43
481
351
93
0
X
 
 
25674
MALT1 subunit 1
272
864
272
0
X
 
 
25673
3-stranded parallel beta-sheet
148
0
0
0
X
 
 
25672
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
184
0
0
0
 
X
 
25671
HIV ISS element
172
0
0
0
 
 
X
25670
Enterocin HF
203
0
0
0
X
 
 
25669
self complementary Xylonucleic Acid duplex
74
72
0
7
 
 
X
25668
Q343R Mutant of TDP-43 Amyloidogenic Core Region
116
106
42
0
X
 
 
25667
G335D Mutant of TDP-43 Amyloidogenic Core Region
139
118
46
0
X
 
 
25666
or34
509
301
85
0
X
 
 
25665
cMSD1
331
734
176
0
X
 
 
25664
NESG Target OR34
509
301
85
0
X
 
 
25663
Link HUMAN TSG-6
575
358
93
0
X
 
 
25662
or446
585
422
99
0
X
 
 
25659
TDP-43 Amyloidogenic Core Region
137
144
46
0
X
 
 
25658
METAL-BINDING SITE OF THE MEMBRANE FUSION PROTEIN SILB
798
678
159
0
X
 
 
25657
Proteasome protein fragment
477
304
63
0
X
 
 
25656
Translation initiation factor IF-1 from Burkholderia thailandensis E264
312
281
71
0
X
 
 
25655
II-III-VI three-way junction from the VS ribozyme in complex with MAGNESIUM
511
394
51
0
 
 
X
25654
II-III-VI three-way junction from the VS ribozyme
511
394
51
0
 
 
X
25653
ASTEROPSIN G
176
107
0
0
X
 
 
25652
PTBRRM1-SL23H complex
869
535
119
0
X
 
X
25651
active G-quadruplex motif from AGRO100
247
0
0
0
 
X
 
25650
RNA recognition motif-1 of serine/arginine-rich protein 1
415
356
84
0
X
 
 
25649
Human Brd4 ET domain in complex with MLV Integrase C-term
449
354
86
0
X
 
 
25648
p75-TMDCD/LPN
177
121
32
0
X
 
 
25647
p75-TMDCD/DPC
338
245
61
0
X
 
 
25646
p75-TMICD/LPN
336
0
0
0
X
 
 
25645
HSPB1_ACD
189
176
81
0
X
 
 
25643
Amino-terminal domain of Latrodectus hesperus MaSp1 with neutralized acidic cluster
618
367
128
0
X
 
 
25642
cytoskeletal bactofilin BacA
97
418
102
0
X
 
 
25640
INTERACTION OF CYTOCHROME C AND CARDIOLIPIN
603
396
103
0
X
 
 
25639
LEDGF/p75 IBD in complex with POGZ peptide (1389-1404)
502
345
81
0
X
 
 
25638
C-terminal domain of the chromodomain helicase DNA-binding protein 1
647
467
111
0
X
 
 
25636
AVR-Pia monomer
381
196
61
0
X
 
 
25634
ABD monomer
305
214
53
0
X
 
 
25632
TBD_1-22
236
135
46
0
X
 
 
25631
ace-pvhct-nh2
134
0
0
0
X
 
 
25630
nonspecific lipid transport protein from the dill Anethum graveolens L.
498
361
102
0
X
 
 
25627
meiosis-expressed gene 1 (Meig1)
553
410
99
0
X
 
 
25626
G88A,D90R double mutant of KaiB
66
208
66
0
X
 
 
25625
G89A,D91R double mutant of KaiB bound to CI
49
155
49
0
X
 
 
25624
G89A,D91R double mutant of KaiB
94
309
94
0
X
 
 
25623
G89A,D91R double mutant of dimeric KaiB
85
271
85
0
X
 
 
25622
D91R single mutant of dimeric KaiB (thioredoxin-like fold)
77
244
77
0
X
 
 
25621
D91R single mutant of dimeric KaiB
51
168
51
0
X
 
 
25620
G89A single mutant of dimeric KaiB
61
199
61
0
X
 
 
25619
N-SasA bound to CI
69
235
69
0
X
 
 
25618
N-SasA
79
175
79
0
X
 
 
25617
dimeric KaiB bound to CI
44
144
44
0
X
 
 
25616
KaiB dimer
89
281
89
0
X
 
 
25615
insulin analogue
289
0
0
0
X
 
 
25614
insulin analogue
240
77
0
0
X
 
 
25613
[B26-B29 triazole cross-linked]-insulin analogue
289
106
7
0
X
 
 
25612
OR358
426
306
70
0
X
 
 
25611
OR303
525
366
96
0
X
 
 
25610
pheromone Ep-1 from Euplotes petzi
145
0
0
0
X
 
 
25609
RsAFP2
309
142
51
0
X
 
 
25605
HsAFP1
307
99
39
0
X
 
 
25604
double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA
180
151
0
22
 
 
X
25603
murine tumour necrosis factor alpha CDE RNA
185
148
33
21
 
 
X
25602
GAT
87
263
87
0
X
 
 
25601
closed state of Lys63-linked diubiquitin
135
0
135
0
X
 
 
25600
LigA4 Big domain
385
247
105
0
X
 
 
25599
Sds3 in complex with Sin3A
819
631
154
0
X
 
 
25598
ASTEROPSIN F FROM MARINE SPONGE ASTEROPUS
184
96
0
0
X
 
 
25597
Dynorphin 1-13 bound to Kappa Opioid Receptor
109
18
18
0
X
 
 
25596
G-quadruplex
166
0
0
0
 
X
 
25595
TDP-43 prion-like hydrophobic helix in DPC
155
84
40
0
X
 
 
25593
HER2/ErbB2 dimeric transmembrane domain
318
219
54
0
X
 
 
25592
Vpu cytoplasmic domain
104
142
52
0
X
 
 
25588
High-affinity calmodulin complexes with vanilloid ligands of TRPV1
515
464
145
0
X
 
 
25587
Miz-1 zinc fingers 2 to 4
466
395
99
0
X
 
 
25586
wt NS4A N-terminal domain of DENV
41
92
41
0
X
 
 
25585
contryphan-Vc1
175
110
32
0
X
 
 
25584
complex between the PH domain of the Tfb1 subunit from TFIIH and the N-terminal activation domain of EKLF (TAD1)
794
578
144
0
X
 
 
25583
Complex between the Transactivation Domain of p65 and p62/Tfb1 subunit of TFIIH
856
641
152
0
X
 
 
25582
Protein and DNA complex
107
76
14
0
X
X
 
25577
human SUMO2
578
411
106
0
X
 
 
25576
human SUMO1
607
433
104
0
X
 
 
25575
SAP30L corepressor protein
426
247
64
0
X
 
 
25574
Antimicrobial Peptide SmAMP2-2c
152
81
0
0
X
 
 
25573
Myristylated Feline Immunodeficiency Virus Matrix Protein
454
321
120
0
X
 
 
25572
Dad2
50
115
49
0
X
 
 
25571
HIV-1 Core Packaging Signal
695
0
0
0
 
 
X
25570
ns5bc
170
102
24
0
X
 
 
25569
PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptide
211
0
0
0
X
 
 
25568
VSTx1
220
154
39
0
X
 
 
25567
YP_193882.1
795
551
140
0
X
 
 
25566
PrxQ
69
189
69
0
X
 
 
25565
BCOR PUFD
559
447
103
0
X
 
 
25564
Third Type III Domain from Human Fibronectin
557
439
99
0
X
 
 
25562
PR domain from PRDM16
988
737
168
0
X
 
 
25561
ASC PYD
100
192
100
0
X
 
 
25560
MRH-GIIb
517
356
96
0
X
 
 
25559
C-terminal domain of human polymerase Rev1 in complex with PolD3 RIR-motif
585
338
103
0
X
 
 
25557
PrxQ
151
504
151
0
X
 
 
25556
MRG15-MRGBP complex
1210
925
217
0
X
 
 
25555
PvHCt
140
0
0
0
X
 
 
25554
nucleotide-free Ran GTPase
1137
874
294
0
X
 
 
25553
SUMO1 and ZZ-domain from CBP
92
14
92
0
X
 
 
25552
PLK4-PB3 monomer
118
266
82
0
X
 
 
25551
Covalent, disulfide crosslink of V197C/C128A yeast cytochrome c peroxidase and A81C/C102T yeast iso-1 cytochrome c
229
0
229
0
X
 
 
25549
mBMAL2-TAD
41
84
41
0
X
 
 
25548
DHX36
107
77
17
0
X
 
 
25546
MDMX-295
571
398
94
0
X
 
 
25545
MyUb (1080-1122) of human Myosin VI with K63-diUb
945
698
156
0
X
 
 
25544
human Myosin VI isoform3 (1050-1131)
527
366
89
0
X
 
 
25543
human Myosin VI isoform3 (998-1071)
449
294
82
0
X
 
 
25542
MyUb (1080-1131) of human Myosin VI
379
273
64
0
X
 
 
25541
MyUb (1080-1122) of human Myosin VI
316
232
55
0
X
 
 
25540
NSsCT-Tfb1PH complex
807
597
143
0
X
 
 
25539
EPI-X4, a human albumin-derived peptide
100
0
0
0
X
 
 
25538
Mdmx-SJ212
584
401
96
0
X
 
 
25537
Cn-AMP1
31
0
0
0
X
 
 
25536
MDMX-057
580
413
95
0
X
 
 
25533
Ca-bound hN-1 8-11
682
524
161
0
X
 
 
25532
Gag
265
819
265
0
X
 
 
25531
N2-dG IQ at G1 in NarI sequence
156
0
0
0
 
X
 
25530
AQ1974
509
385
77
0
X
 
 
25529
hylin a1
85
0
0
0
X
 
 
25528
DNA Dodecamer with 8-oxoguanine at 4th Position
162
0
0
0
 
X
 
25527
alpha-crystallin domain from human, HSPB5
524
359
95
0
X
 
 
25526
RNA 27-MER, RIBOSTAMYCIN
205
180
27
8
 
 
X
25525
Neuromedin C in presence of SDS micelles
57
34
12
0
X
 
 
25524
Neuromedin C in 90% TFE
56
34
11
0
X
 
 
25523
Neuromedin C in 60% TFE
56
34
11
0
X
 
 
25522
Neuromedin C in 40% TFE
56
33
11
0
X
 
 
25521
Neuromedin C in 25% TFE
57
34
12
0
X
 
 
25520
Neuromedin C in 10% TFE
57
34
12
0
X
 
 
25519
Neuromedin C in water
57
34
12
0
X
 
 
25517
Short hydrophobic peptide, 11mer
20
0
0
0
X
 
 
25516
Disulfide-Deleted Mutant of Analgesic Cyclic alpha-Conotoxin Vc1.1
108
13
0
0
X
 
 
25515
non-phosphorylated J-domain of Human Cysteine String Protein (CSP)
555
410
104
0
X
 
 
25514
phosphorylated J-domain of Human Cysteine String Protein (CSP)
553
400
106
0
X
 
 
25513
TSPO A147T variant in complex with PK11195
955
588
171
0
X
 
 
25512
VirB9 C-terminal domain in complex with VirB7 N-terminal domain from Xanthomonas citri's T4SS
746
470
114
0
X
 
 
25511
cChimeraX-A162H, Ca2+ bound
91
0
91
0
X
 
 
25510
AIM2 PYD from Mus musculus
477
378
94
0
X
 
 
25509
APOBEC3G NTD variant, sNTD
289
317
147
0
X
 
 
25508
Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710b
430
361
93
0
X
 
 
25505
CCR5-ECL2 helical structure, residues Q186-T195
20
30
10
0
X
 
 
25504
Staphylococcus aureus FusB:EF-GC3 complex
283
246
283
0
X
 
 
25502
Peptidyl-prolyl cis-trans isomerase A
977
445
173
0
X
 
 
25501
SH2-SH3 adapter protein drk
110
293
110
0
X
 
 
25500
SH2-SH3 adapter protein drk
97
297
97
0
X
 
 
25499
RRM3 domain of Hrb1
559
288
113
0
X
 
 
25498
RRM2 domain of Hrb1
527
409
102
0
X
 
 
25497
RRM1 domain of Hrb1
486
371
89
0
X
 
 
25496
RRM3 domain of Gbp2
569
369
112
0
X
 
 
25495
cNTnC-cTnIA162H
595
239
83
0
X
 
 
25494
First and Second KH domains of hnRNP E1
527
421
148
0
X
 
 
25493
Human Med26 N-Terminal Domain (1-92)
411
384
94
0
X
 
 
25492
HIRAN
615
466
116
0
X
 
 
25491
Conantokin Rl-B
106
73
17
0
X
 
 
25490
Conantokin Rl-B
97
74
18
0
X
 
 
25489
PRO Form of Human Matrilysin (proMMP-7) in Complex with Anionic Membrane
994
62
223
0
X
 
 
25488
PRO Form of Human Matrilysin (proMMP-7) in Complex with Zwitterionic Membrane
994
62
223
0
X
 
 
25487
Purotoxin-2 in DPC micelles
369
176
62
0
X
 
 
25486
Purotoxin-2 in water
41
0
41
0
X
 
 
25485
PRO Form of Human Matrilysin (proMMP-7)
1274
1003
237
0
X
 
 
25484
p300 Taz2-p53 TAD2 Complex
627
442
99
0
X
 
 
25483
Metal Binding of Glutaredoxins
481
361
88
0
X
 
 
25482
GTP:adenosylcobinamide-phosphate guanylyltransferase (CobY)
1112
705
156
0
X
 
 
25479
Rad6
76
0
76
0
X
 
 
25478
IL4pSER411
78
0
0
0
X
 
 
25477
oxidized triheme cytochrome PpcA
405
0
63
0
X
 
 
25476
His_ST-Crl
787
570
131
0
X
 
 
25475
Tau(267-312) bound to Microtubules
43
0
0
0
X
 
 
25474
Protegrin-3 (PG3)
110
56
14
0
X
 
 
25472
mu-SLPTX-Ssm6a
205
0
0
0
X
 
 
25471
IL4pSER415
69
0
0
0
X
 
 
25470
IL4pSER402
74
0
0
0
X
 
 
25469
hnRNP C RRM in complex with 5'-UUUUC-3' RNA
651
428
117
0
X
 
X
25468
PDFL2.1
330
161
55
0
X
 
 
25467
GB1-PLAT (PKD1_PLAT)
109
325
109
0
X
 
 
25465
ConRlBNQO
91
67
19
0
X
 
 
25464
MbtH-like protein from Mycobacterium marinum
352
267
65
0
X
 
 
25463
NS1B ED dimer
136
376
135
0
X
 
 
25462
NS1B ED mutant monomer
136
408
136
0
X
 
 
25461
CUE domain of yeast Cue1
426
305
81
0
X
 
 
25460
Fungus protein B9WZW9_MAGOR
418
228
81
0
X
 
 
25459
Fungus protein Q8J180_MAGGR
423
238
86
0
X
 
 
25458
Odin-Sam1 fragment
267
0
0
0
X
 
 
25457
Cullin3 - BTB interface
119
0
0
0
X
 
 
25456
Cullin3 - BTB interface
120
0
0
0
X
 
 
25454
bacterial chaperone
444
337
86
0
X
 
 
25453
Human galectin-8
659
537
129
0
X
 
 
25452
Omega-Tbo-IT1 Selective Inhibitor of Insect Calcium Channels
223
114
0
0
X
 
 
25451
dithiolic glutaredoxin 2-C-Grx1 from the pathogen Trypanosoma brucei brucei
536
404
92
0
X
 
 
25449
RNA recognition motif of a cyclophilin33 - like protein from Plasmodium falciparum
449
366
97
0
X
 
 
25448
N-terminal domain of human TIG3
624
355
112
0
X
 
 
25447
KstB-PCP(apo)
479
273
92
0
X
 
 
25446
KstB-PCP (holo)
464
233
89
0
X
 
 
25445
A2A-ct
111
344
122
0
X
 
 
25443
Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Pml1p(22-42)
782
572
135
0
X
 
 
25442
Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Bud13p(215-255
867
527
148
0
X
 
 
25441
VP8
142
466
142
0
X
 
 
25440
Bud31p protein
27
0
0
0
X
 
 
25439
Bud31p protein
878
509
167
0
X
 
 
25437
Endo T5-ZN+2
792
475
135
0
X
 
 
25436
hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNA
664
464
117
0
X
 
X
25435
Amylase binding Protein A
825
640
177
0
X
 
 
25434
OCRE
505
294
93
0
X
 
 
25433
RBM10_ZnF1
210
140
39
0
X
 
 
25432
TOG
1499
1120
253
0
X
 
 
25430
GADD34 PP1 complex
226
203
63
0
X
 
 
25428
acidic domain of SYNCRIP (hnRNPQ)
491
339
92
0
X
 
 
25425
transforming growth factor beta induced protein (TGFBIp)
148
540
148
0
X
 
 
25424
DEFA1, a highly potent antimicrobial peptide from the horse
138
0
0
0
X
 
 
25423
NDP52 ubiquitin-binding zinc finger
211
103
34
0
X
 
 
25422
human Cyt c G41S mutant (ferric)
91
277
91
0
X
 
 
25421
G7W/N24S Hhn2b
202
145
35
0
X
 
 
25420
human Cyt c G41S mutant (ferrous)
94
194
94
0
X
 
 
25419
TRTX-Tp1a from the tarantula Thrixopelma pruriens
207
0
0
0
X
 
 
25418
human Cyt c
101
193
99
0
X
 
 
25417
CadC1-159
617
482
156
0
X
 
 
25416
RNA (39-MER), 3' splice site in influenza A: 39-nt hairpin
166
0
0
0
 
 
X
25415
3' splice site influenza A: 19-nt duplex
140
0
0
14
 
 
X
25414
3' splice site influenza A: 11-nt hairpin
97
0
0
10
 
 
X
25411
MPMV MA T41I T78I
577
374
100
0
X
 
 
25410
Sigma-1 receptor delta 35 construct
168
429
169
0
X
 
 
25409
VG16KRKP, an antimicrobial peptide in SDS
83
0
0
0
X
 
 
25408
VG16KRKP, an antimicrobial peptide in D8PG micelles
83
0
0
0
X
 
 
25407
DNA complex of the C-Terminal domain of MvaT
492
163
51
0
X
X
 
25406
H56P
76
0
76
0
X
 
 
25405
C-terminal domain of MvaT
287
207
50
0
X
 
 
25404
VPg of porcine sapovirus
379
277
67
0
X
 
 
25403
Clathrin Heavy Chain
269
869
268
0
X
 
 
25402
SNX3FL
1001
729
165
0
X
 
 
25401
CCL28
604
434
110
0
X
 
 
25400
lcFABP
713
512
136
0
X
 
 
25399
Medin
66
144
48
0
X
 
 
25398
N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 5.5
718
469
145
0
X
 
 
25397
N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 7.2
695
504
140
0
X
 
 
25396
mouse EpoR
183
136
45
0
X
 
 
25395
internal EH domain of gamma-synergin
626
382
86
0
X
 
 
25394
complex of Dvl PDZ domain with ligand
39
24
0
0
X
 
 
25393
IST1 peptide
56
184
56
0
X
 
 
25391
tumor protein monomer
929
709
165
0
X
 
 
25390
holo-axxa_cytc
75
0
75
0
X
 
 
25389
holo-wt-cytc
75
0
75
0
X
 
 
25387
bpsl1445
849
663
168
0
X
 
 
25386
zinc finger domain
356
267
78
0
X
 
 
25385
Ssa1 substrate binding domain
909
727
176
0
X
 
 
25384
BecN-150CSY monomer
293
438
142
0
X
 
 
25383
human TRAP1-NTD
158
472
158
0
X
 
 
25382
UBX-L domain of VCIP135
552
316
79
0
X
 
 
25381
E. coli threonylcarbamoyl-AMP synthase TsaC
874
723
168
0
X
 
 
25380
HP0268 from Helicobacter pylori
403
328
80
0
X
 
 
25379
PsbP
1084
749
194
0
X
 
 
25378
A G-quadruplex structure
232
0
0
0
 
X
 
25377
MDMX-P53
447
0
0
0
X
 
 
25376
RING Domain of human Promyelocytic Leukemia Protein (PML)
319
173
57
0
X
 
 
25375
PTP1B CPT-157633 Complex
212
244
212
0
X
 
 
25372
CG KIX
481
338
82
0
X
 
 
25370
Crotalicidin-Ct
152
82
0
0
X
 
 
25367
YMRRA
160
445
160
0
X
 
 
25366
crotalicidin-Nt
111
52
0
0
X
 
 
25365
SLBP
37
92
37
0
X
 
 
25364
SLBP/RNA
62
148
62
0
X
 
X
25363
crotalicidin in DPC micelles
263
105
0
0
X
 
 
25362
Y171W mutant of Adenylate Kinase in complex with Ap5a for state b
61
0
61
0
X
 
 
25361
Y171W mutant of Adenylate Kinase in complex with Ap5a for state a
194
0
194
0
X
 
 
25360
P177A mutant of Adenylate Kinase in complex with Ap5a
181
0
181
0
X
 
 
25359
BamA
20
41
20
0
X
 
 
25358
periplasmic domain of a cellulose-sensing trans-membrane anti-sigma factor
993
741
180
0
X
 
 
25357
Adenylate Kinase Y171W
200
0
200
0
X
 
 
25356
TPMT *1 16-245
157
488
157
0
X
 
 
25355
EphB2 kinase domain
240
799
240
0
X
 
 
25354
Abp1p SH3 domain
265
215
57
0
X
 
 
25353
Kinase
198
0
198
0
X
 
 
25352
Acidocin B
279
0
0
0
X
 
 
25350
PsbQ from spinacia oleracea
770
638
148
0
X
 
 
25349
WW3
265
184
44
0
X
 
 
25348
53BP1 tandem Tudor domains in complex with a p53K382me2 peptide
801
584
115
0
X
 
 
25347
53BP1 tandem Tudor domains in complex with a p53K370me2 peptide
804
585
116
0
X
 
 
25346
MG200 EAGRbox
220
317
79
0
X
 
 
25345
PfCDPK3 CLD(B)
84
245
84
0
X
 
 
25344
CaM Tr2C, monomer
397
305
71
0
X
 
 
25343
Talin-F3 / RIAM N-terminal Peptide complex
603
0
90
0
X
 
 
25342
NMR structure of the protein YP_193882.1 from Lactobacillus acidophilus NCFM in presence of FMN
866
607
161
0
X
 
 
25341
CypC
180
351
180
0
X
 
 
25340
CypD+peptide
150
291
150
0
X
 
 
25339
CypC+peptide
175
0
175
0
X
 
 
25338
CypB+peptide
164
310
164
0
X
 
 
25337
CypA+peptide
157
298
157
0
X
 
 
25336
GeoCyp+peptide
132
265
132
0
X
 
 
25335
VG16KRKP, an antimicrobial peptide in LPS
90
0
0
0
X
 
 
25333
hL-FABP:TCH
130
250
130
0
X
 
 
25332
Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1, Ser3, and Ser14
196
0
0
0
X
 
 
25331
Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1 and Ser3
194
0
0
0
X
 
 
25330
HUAB
168
501
168
0
X
 
 
25329
HUB2
85
252
85
0
X
 
 
25328
HUA2
86
254
86
0
X
 
 
25327
Bd0108
249
271
69
0
X
 
 
25326
carboxy-terminal domain of DNTTIP1
618
382
108
0
X
 
 
25325
Protein Hybrid Beta-Synuclien HC
133
260
133
0
X
 
 
25324
ligand-free OAA
717
511
157
0
X
 
 
25315
FBP28 WW2 mutant Y438R DN
184
0
0
0
X
 
 
25314
FBP28 WW2 mutant Y438R L453A DNDC
154
0
0
0
X
 
 
25313
FBP28 WW2 mutant Y438R DNDC
157
0
0
0
X
 
 
25312
MBD1 CXXC1
294
0
62
0
X
 
 
25311
FBP28 WW2 mutant W457F
192
0
0
0
X
 
 
25310
FBP28 WW2 mutant Y446L
196
0
0
0
X
 
 
25309
FBP28 WW2 , mutation Y438R
194
0
0
0
X
 
 
25308
obscurin Ig58
493
376
91
0
X
 
 
25307
SATB1 homeodomain
82
0
73
0
X
 
 
25306
OAA monomer
717
511
157
0
X
 
 
25305
titin M10
83
238
83
0
X
 
 
25304
obscurin Ig1 bound to titin M10
76
0
76
0
X
 
 
25303
titin M10-obscurin-Ig1
79
0
79
0
X
 
 
25302
Monomer of Mo3964
200
144
37
0
X
 
 
25301
OBSC-Ig1
78
263
78
0
X
 
 
25300
bee venom toxin melittin with [(C5H5)Ru]+ fragment attached to the tryptophan residue
136
22
0
0
X
 
 
25299
Human Small Ubiquitin like Modifier protein-1 (SUMO-1)
396
383
94
0
X
 
 
25298
Tetramerization domain of the Ciona intestinalis p53/p73-b transcription factor protein
297
218
46
0
X
 
 
25297
lasso peptide streptomonomicin
122
21
0
0
X
 
 
25296
Hha-H-NS46 charge zipper complex
120
0
115
0
X
 
 
25294
NP_809137.1 monomer
668
384
124
0
X
 
 
25293
Kalata B7 Ser mutant
152
70
22
0
X
 
 
25292
RT216
131
284
131
0
X
 
 
25291
RNA duplex
77
48
0
8
 
 
X
25288
TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)
610
362
108
0
X
 
 
25287
5-phenyl-3-oxo-pentyl Actinorhodin Acyl Carrier Protein from Streptomyces coelicolor
484
355
90
0
X
 
 
25284
3,7-dioxo-octyl Actinorhodin Acyl Carrier Protein
455
339
86
0
X
 
 
25283
scoloptoxin SSD609 from Scolopendra mutilans
217
0
0
0
X
 
 
25282
MJ0366
176
269
92
0
X
 
 
25281
YERSINIA PESTIS AIL (ATTACHMENT INVASION LOCUS)
146
280
146
0
X
 
 
25280
mouse BMAL1 transactivation domain
257
200
49
0
X
 
 
25278
RisS
75
247
77
0
X
 
 
25277
lantibiotic self-resistance lipoprotein MlbQ from Microbispora ATCC PTA-5024
461
347
82
0
X
 
 
25276
eEF1Bdelta CAR domain in TCTP-bound state
228
159
44
0
X
 
 
25275
eEF1Bdelta CAR domain
244
173
44
0
X
 
 
25274
cytosolic part of Trop2
168
74
21
0
X
 
 
25273
phosphorylated cytosolic part of Trop2
131
0
0
0
X
 
 
25270
SpoVM P9A mutant
142
97
24
0
X
 
 
25269
ASM1
252
152
45
0
X
 
 
25268
SpoVM
140
89
22
0
X
 
 
25267
TRIM25 (PRYSPRY) domain
183
544
183
0
X
 
 
25266
decorin binding protein B
788
711
173
0
X
 
 
25265
Uncharacterized protein
502
365
86
0
X
 
 
25264
60S pre-ribosome
89
176
89
0
X
 
 
25263
CUS-3id
612
461
119
0
X
 
 
25261
[GlnB22]-insulin mutant
288
0
0
0
X
 
 
25260
human insulin
297
131
40
0
X
 
 
25259
hypothetical protein NP_344732.1 from Streptococcus pneumoniae TIGR4
962
565
175
0
X
 
 
25257
Y99E CAM-eNOS
141
0
141
0
X
 
 
25254
toxin, RhTx
143
0
0
0
X
 
 
25253
Y99E,N111D CAM-iNOS
656
0
144
0
X
 
 
25251
PrPdelta193-196
674
138
146
0
X
 
 
25250
PrPdelta190-197
778
569
141
0
X
 
 
25244
HuR_RRM1 monomer
554
412
106
0
X
 
 
25243
Arsenate Reductase
723
542
138
0
X
 
 
25242
Sk45mNoTag
1204
488
225
0
X
 
 
25241
N-domain of the AAA metalloproteinase Yme1
426
318
56
0
X
 
 
25240
Twinstar from Drosophila melanogastor
874
652
146
0
X
 
 
25239
La-RRM1
938
706
162
0
X
 
 
25238
Human Relaxin-2
273
87
0
0
X
 
 
25237
MBP
464
1137
340
0
X
 
 
25235
FtsH periplasmic N-domain
19
12
3
0
X
 
 
25232
F231L mutant ERCC1-XPF dimerization region
971
695
172
0
X
 
 
25231
14-3-3 Zeta
190
377
189
0
X
 
 
25230
Human FAAP20 UBZ-Ubiquitin Complex
710
522
122
0
X
 
 
25229
Human FAAP20 UBZ
233
142
40
0
X
 
 
25228
aSyn H50Q monomer
275
399
131
0
X
 
 
25227
aSyn WT monomer
269
388
131
0
X
 
 
25226
cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)
447
247
82
0
X
 
 
25225
trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)
441
239
81
0
X
 
 
25224
human IgG-Fc
197
542
198
0
X
 
 
25223
mu-SLPTX3-Ssm6a
270
188
49
0
X
 
 
25222
Phospholamban
49
0
49
0
X
 
 
25221
PHD domain of Yeast YNG2
310
213
49
0
X
 
 
25220
RNA duplex
83
28
0
9
 
 
X
25219
UBM1 domain of human HUWE1/ARF-BP1
271
195
45
0
X
 
 
25218
amyloid beta
192
78
42
0
X
 
 
25217
AUX IAA17
520
428
108
0
X
 
 
25215
SERA protein peptide analogue 6737
131
0
0
0
X
 
 
25214
High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1
420
225
66
0
X
 
 
25213
High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1
304
175
48
0
X
 
 
25212
protegrin-2 docked to DPC Micelles
95
0
0
0
X
 
 
25211
peptide 6762
136
0
0
0
X
 
 
25210
PUTATIVE MEMBRANE PROTEIN IGAA HOMOLOG
705
524
111
0
X
 
 
25209
synthetic peptide 36075
129
0
0
0
X
 
 
25207
1585 Malarial Peptide
140
0
0
0
X
 
 
25206
high-activity binding peptide 6505
95
0
0
0
X
 
 
25205
analgesic sea anemone peptide APETx2
228
0
0
0
X
 
 
25204
Malarial Peptide 6673
137
0
0
0
X
 
 
25203
Peptide of acidic-basic repeat antigen (ABRA) from Plasmodium falciparum
128
0
0
0
X
 
 
25202
PEPTIDE BELONGING THE N-TERMINAL REGION DERIVED OF MEROZOITE SURFACE PROTEIN-2 OF PLASMODIUM FALCIPARUM
124
0
0
0
X
 
 
25201
1513 MSP-1 peptide
109
0
0
0
X
 
 
25200
STARP peptide 20570
129
0
0
0
X
 
 
25199
myrGCAP2
167
356
167
0
X
 
 
25197
wrapping silk W2
374
786
374
0
X
 
 
25196
haloSRC
81
217
81
0
X
 
 
25195
putative arsenate reductase from Brucella melitensis
639
524
115
0
X
 
 
25194
NisI
710
537
138
0
X
 
 
25193
NisI
217
641
217
0
X
 
 
25192
L,D-transpeptidase in complex with a peptidoglycan hexamuropeptide
96
96
96
0
X
 
 
25191
STARP peptide 20546
126
0
0
0
X
 
 
25190
malaria short AMA-1 peptide analogue
118
0
0
0
X
 
 
25189
malaria peptide 1815
113
0
0
0
X
 
 
25188
YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNA
966
683
155
0
X
 
X
25187
Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-trans dicarba RgIA
72
32
11
0
X
 
 
25186
Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-cis dicarba RgIA
73
41
11
0
X
 
 
25185
FG-N-6His
120
352
120
0
X
 
 
25184
FG-N
78
256
78
0
X
 
 
25183
FSFG-K-6His
113
361
113
0
X
 
 
25182
FSFG-K
109
350
109
0
X
 
 
25181
Hepatitis C Virus p7
58
61
58
0
X
 
 
25180
mutNS4A
145
137
46
0
X
 
 
25179
wtNS4A
154
137
46
0
X
 
 
25177
De Novo Designed Peptide that Sequesters Toxic Heavy Metals
393
298
69
0
X
 
 
25176
Filamin repeat 21 bound to integrin
784
400
133
0
X
 
 
25175
NisI
669
493
117
0
X
 
 
25174
Non-reducible analogues of alpha-conotoxin RgIA: [2,8]-cis dicarba RgIA
72
37
11
0
X
 
 
25173
N-terminal dopmain of NikR
48
143
49
0
X
 
 
25172
Ca-bound hN-1 4-7
668
489
146
0
X
 
 
25171
MLL-IBD complex
588
533
148
0
X
 
 
25169
Stable Peptide Biomarker RCB-1
108
38
15
0
X
 
 
25168
flpp3Sol 2
534
421
112
0
X
 
 
25167
Human Shq1 CS domain
86
261
86
0
X
 
 
25166
ectodomain of the B. subtilis RodZ
651
480
110
0
X
 
 
25165
OR109
511
377
92
0
X
 
 
25164
three-way junction from the VS ribozyme
368
286
39
0
 
 
X
25163
three-way junction from the VS ribozyme
368
286
39
0
 
 
X
25162
CrnA2'
140
0
0
0
X
 
 
25161
CrnA1'
180
0
0
0
X
 
 
25160
RRM1 of human LARP6
559
461
104
0
X
 
 
25159
LARP6-LaM
545
416
98
0
X
 
 
25158
Doc48S monomer
398
299
78
0
X
 
 
25157
Decorin Binding Protein A
781
682
155
0
X
 
 
25156
Decorin Binding Protein A
517
427
156
0
X
 
 
25155
apo FldB
785
623
160
0
X
 
 
25154
DMXAA-bound mSTING dimer
234
663
221
0
X
 
 
25153
holo FldB
963
750
185
0
X
 
 
25152
MTAbl13, a grafted MCoTI-II
211
0
0
0
X
 
 
25151
Hs1a
208
111
39
0
X
 
 
25150
human ubiquitin conjugating enzyme Ube2w
224
367
113
0
X
 
 
25149
Isolated Ring domain
421
292
76
0
X
 
 
25148
NTD-NUSA
710
530
121
0
X
 
 
25147
DNA binding domain of sigma 54 from E.coli
408
281
71
0
X
 
 
25142
Hox homeodomain
363
285
71
0
X
 
 
25141
EL_LovR
70
232
70
0
X
 
 
25140
apo EL_LovR
304
186
68
0
X
 
 
25139
MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1
554
381
105
0
X
 
 
25138
DRB4(1-153)
797
559
148
0
X
 
 
25137
EL_LovR
705
530
121
0
X
 
 
25135
MLKL N-terminal domain
967
690
169
0
X
 
 
25131
Kindlin-2 F2
88
0
0
0
X
 
 
25130
LEDGF/p75 IBD in complex with MLL1 peptide (140-160)
614
372
89
0
X
 
 
25129
P-superfamily conotoxin Bru9a cyclised with a Gly-Leu-Pro linker
129
0
0
0
X
 
 
25128
P-superfamily conotoxin Gm9a cycled with a Gly-Leu-Pro linker
146
0
0
0
X
 
 
25127
putative phosphoglycolate phosphatase
1035
696
230
0
X
 
 
25125
Apo form of the Receiver Domain of Nitrogen Regulatory Protein C ( NTRC ) at 35C
713
542
124
0
X
 
 
25124
BeF3 activated Receiver Domain of Nitrogen Regulatory Protein C ( NtrC ) at 35C
712
549
126
0
X
 
 
25122
SCORPION VENOM TOXIN Ts11 (TsPep1) FROM Tity
150
72
0
0
X
 
 
25120
cTnC-cTnI[1-73]-cTnI[144-163]
758
615
162
0
X
 
 
25119
cTnI[1-73]-cTnC
369
282
67
0
X
 
 
25118
cTnI[1-73]
264
227
66
0
X
 
 
25116
GTPase KRas-GNP:ARafRBD complex
13
13
0
0
X
 
 
25115
K-Ras and membrane scaffold protein
11
11
0
0
X
 
 
25114
GTPase KRas-GDP tethered to a lipid-bilayer nanodisc
11
11
0
0
X
 
 
25112
circumsporozoite protein peptide
81
0
0
0
X
 
 
25110
left-handed G-quadruplex
267
0
0
0
 
X
 
25109
MAVS CARD
600
428
116
0
X
 
 
25108
PfI2
95
300
93
0
X
 
 
25107
DNA-quercetin
61
0
0
0
 
X
 
25106
CAG RNA
33
0
0
0
 
 
X
25104
CYCLOPHILIN A COMPLEXED WITH A FRAGMENT OF CRK-II
874
670
167
0
X
 
 
25102
rubredoxin domain of the NO Reductase Flavorubredoxin
322
0
54
0
X
 
 
25101
tRNApro:MLV Nucleocapsid Protein (1:1) Complex
222
33
0
0
X
 
X
25100
pf tRNApro:MLV-Nucleocapsid (1:2) Complex
219
33
0
0
X
 
X
25099
Hs2 dimer
100
0
0
0
 
X
 
25098
copper binding protein in the apo form
495
269
84
0
X
 
 
25096
MciZ from Bacillus subtilis
227
0
0
0
X
 
 
25094
EcMazE homodimer
81
0
78
0
X
 
 
25093
EcMazE homodimer
411
323
79
0
X
 
 
25092
MazE-DNA binding
65
0
61
0
X
X
 
25088
Ddi1UBL
465
331
84
0
X
 
 
25087
MPMV MA Y28F Y67F
789
575
141
0
X
 
 
25086
truncated EcMazE
362
269
65
0
X
 
 
25085
rhodanese domain of YgaP
580
415
102
0
X
 
 
25083
Putative uncharacterized protein BTH I2711
372
321
76
0
X
 
 
25082
Fyn SH2 domain in complex with the natural inhibitory phosphotyrosine peptide
53
0
0
0
X
 
 
25081
Fyn SH2 bound
668
497
115
0
X
 
 
25080
[FeZn]IMP-1
156
162
156
0
X
 
 
25079
human EpoR
131
90
42
0
X
 
 
25078
CSD1-SXL-18-mer msl2 mRNA
64
91
62
0
X
 
 
25077
PTPN4 PDZ-linker
116
367
116
0
X
 
 
25072
SXL-UNR-msl2-mRNA
152
130
152
0
X
 
X
25071
Rad18-UBZ
142
102
27
0
X
 
 
25070
Rad18-UBZ/ubiquitin complex
602
438
106
0
X
 
 
25069
human Ca2+-loaded S100A4 cys-free mutant
556
400
103
0
X
 
 
25068
High mobility group protein from Plasmodium falciparum 3D7
419
351
80
0
X
 
 
25067
NESG Target OR459
660
486
104
0
X
 
 
25066
UBA domain of DNA-damage-inducible 1 protein (Ddi1)
246
0
45
0
X
 
 
25065
PCP7T holo form
480
196
74
0
X
 
 
25064
PCP7T
367
156
70
0
X
 
 
25063
[ZnZn]-IMP-1
196
555
196
0
X
 
 
25062
OR462
823
602
136
0
X
 
 
25061
Structure of De novo designed Protein OR457
780
583
120
0
X
 
 
25060
dCDS1-RNA
199
179
70
0
X
 
X
25059
dCSD1
355
270
72
0
X
 
 
25052
Nucleocapsid protein p10 and RNA (68-MER)
238
0
0
0
X
 
X
25050
membrane-active toxin from crab spider Heriaeus melloteei
206
88
0
0
X
 
 
25049
RNA (68-MER)
185
148
27
0
 
 
X
25048
Transient Collagen Triple Helix Binding to a Key Metalloproteinase
205
502
167
0
X
 
 
25047
RRM-PEPTIDE and RES COMPLEX
747
427
132
0
X
 
 
25046
DC-SIGNR CRD apo
84
0
84
0
X
 
 
25043
Most two C-terminal RNA Recognition Motif Domain of hnRNP L bound to two equivalents ACACA RNA
1276
700
223
0
X
 
X
25042
Second RNA Recognition Motif Domain of hnRNP L bound to ACACAC RNA
738
419
134
0
X
 
X
25041
First RNA Recognition Motif Domain of hnRNP L bound to CACACA RNA
613
363
102
0
X
 
X
25040
most two C-terminal RNA Recognition Motif Domain of hnRNP L
1083
587
216
0
X
 
 
25039
Second RNA Recognition Motif Domain of hnRNP L
662
366
129
0
X
 
 
25038
hnRNP L
555
318
103
0
X
 
 
25037
N terminal domain of the MuB AAA+ ATPase
382
183
68
0
X
 
 
25036
CsUbl
378
244
80
0
X
 
 
25035
cChimeraX Ca2+ bound
101
188
101
0
X
 
 
25034
cChimera Ca2+ bound
171
0
95
0
X
 
 
25033
Chlamydomonas reinhardtii NAB1 cold shock domain, CSD1
364
265
71
0
X
 
 
25032
bacterial immunoglobulin-like domain form a surface protein of Leptospira
411
193
108
0
X
 
 
25031
spider-venom peptides against the analgesics target NaV1
197
140
35
0
X
 
 
25030
OMPA C-terminal domain
127
0
127
0
X
 
 
25029
hGH
148
455
148
0
X
 
 
25028
NMR structure of the hypotheical protein Lreu_0056 from Lactobacillus reuteri
709
419
125
0
X
 
 
25027
NMR structure of the hypothetical protein BVU_0925 from Bacteroides vulgatus ATCC 8482
560
324
107
0
X
 
 
25026
NMR structure of putative beta-lactamase (NP_372339.1) from Staphylococcus aureus Mu50
860
484
164
0
X
 
 
25024
RP domain of MiSp
257
136
112
0
X
 
 
25023
Drosophila ELF domain from FANCL
81
0
74
0
X
 
 
25022
Polyglutamine binding peptide 1 (QBP1)
69
44
11
0
X
 
 
25021
ROQ domain
148
439
148
0
X
 
 
25020
E55Q mutant of eRF1 N-domain
788
444
146
0
X
 
 
25019
DHFR-folate
140
295
140
0
X
 
 
25018
OR414
638
475
107
0
X
 
 
25016
Y125F mutant of eRF1 N-domain
793
441
146
0
X
 
 
25012
Cysteine Deleted Protegrin-1 (CDP-1): lr10
46
0
0
0
X
 
 
25011
Cysteine Deleted Protegrin-1 (CDP-1): rr11
49
0
0
0
X
 
 
25010
Hypertrophic Cardiomyopathy-Related R502W Mutant
556
326
100
0
X
 
 
25009
Cysteine Deleted Protegrin-1 (CDP-1): rr14
57
0
0
0
X
 
 
25008
Phosphotyrosine binding domain
458
63
89
0
X
 
 
25007
C3 DOMAIN OF CARDIAC MYOSIN BINDING PROTEIN-C, WT
560
423
99
0
X
 
 
25002
LysM region of the E. coli Intimin periplasmic domain
456
315
82
0
X
 
 
25001
aggregative adherence fimbriae
747
595
134
0
X
 
 
25000
WW3 domain of Nedd4L in complex with its HECT domain PY motif
219
59
27
0
X
 
 
21062
conotoxin Im10A
50
0
0
0
X
 
 
21057
SFTI-TCTR N12 N14
77
0
0
0
X
 
 
21056
SFTI-TCTR N12 N14 NMeSer6
79
0
0
0
X
 
 
21047
AIP-IV peptide
48
0
0
0
X
 
 
21046
AIP-II peptide
43
0
0
0
X
 
 
21045
AIP-I
44
0
0
0
X
 
 
21042
tAIP-III_D2A
32
0
0
0
X
 
 
21041
tAIP-III
33
0
0
0
X
 
 
21040
AIP-III_L7A peptide
38
0
0
0
X
 
 
21039
AIP-III_F5A_peptide
35
0
0
0
X
 
 
21038
AIP-III_DL7 peptide
45
0
0
0
X
 
 
21037
AIP-III_DF5
40
0
0
0
X
 
 
21036
AIP-III_D4A peptide
41
0
0
0
X
 
 
21035
AIP-III
37
0
0
0
X
 
 
21033
Lewisx-FimH
28
20
0
0
X
 
 
21028
MDCSGCSRPG + Zn acidic
48
0
0
0
X
 
 
21027
MDCSGCSRPG + Zn basic
47
0
0
0
X
 
 
21026
MDCSGCSRPG + Zn basic
47
0
0
0
X
 
 
21025
MDCSGCSRPG + Zn acidic
48
0
0
0
X
 
 
21024
MDCSGCSRPG bound to Cu
48
0
0
0
X
 
 
21023
MDCSGCSRPG
48
0
0
0
X
 
 
21022
MDCSGCSRPG
48
0
0
0
X
 
 
21019
Chikungunya Virus Fusion Peptide
61
0
0
0
X
 
 
21018
Compstatin_10
88
0
0
0
X
 
 
21015
conotoxin pu14a
108
0
0
0
X
 
 
21014
conotoxin lt14a
69
0
0
0
X
 
 
21013
RI23
112
0
0
0
X
 
 
21010
extended upain
111
48
0
0
X
 
 
21009
upain-1
76
37
0
0
X
 
 
21008
TemporinL
82
0
0
0
X
 
 
21007
alpha-conotoxin ImI Cystathionine 1-3
64
0
0
0
X
 
 
21006
alpha-conotoxin ImI Cystathionine 2-4
63
0
0
0
X
 
 
21002
Tryptophan Zipper analogue
81
0
0
0
X
 
 
21001
neurotensin
97
0
0
0
X
 
 
21000
MccJ25 RGD
98
0
0
0
X
 
 
20128
conotoxin qc16a
45
0
0
0
X
 
 
20127
nociceptin Agonist
68
0
0
0
X
 
 
20126
Alpha-conotoxin Vc1.2
84
41
17
0
X
 
 
20125
VK22 in DPC micelles
96
0
0
0
X
 
 
20124
[113-122]ApoJ
69
0
0
0
X
 
 
20123
NS4A(1-22)
100
58
0
0
X
 
 
20122
CCAP-vil
57
0
0
0
X
 
 
20121
tubulysin
52
0
0
0
X
 
 
20119
thromboxane A2 receptor
121
0
0
0
X
 
 
20118
C-terminal domain of the Gq protein alpha subunit in the presence of thromboxane A2 receptor
70
0
0
0
X
 
 
20117
Substance P in DMPC/CHAPS/GM1 bicelles
82
0
0
0
X
 
 
20116
Substance P in DMPC/CHAPS bicelles
82
0
0
0
X
 
 
20115
Substance P
82
0
0
0
X
 
 
20114
alpha-conotoxin FI
81
0
0
0
X
 
 
20113
Temporin-SHf
55
29
0
0
X
 
 
20112
Gaq-ct only
82
0
0
0
X
 
 
20111
SecA fragment
106
0
0
0
X
 
 
20110
VPgpU
140
0
1
0
X
 
 
20109
15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide)
78
0
0
0
X
 
 
20108
SecA fragment
114
0
0
0
X
 
 
20107
conotoxin ImI analogue
62
0
0
0
X
 
 
20105
BI
96
0
0
0
X
 
 
20104
xt-7
84
0
0
0
X
 
 
20103
[Lysine4]XT-7
96
0
0
0
X
 
 
20102
t11
109
0
0
0
X
 
 
20101
Substance P
68
0
0
0
X
 
 
20098
Pis-1 [PG]
126
0
0
0
X
 
 
20095
cis Pis-1[NkG]
127
0
0
0
X
 
 
20094
trans Pis-1[NkG]
127
0
0
0
X
 
 
20093
REV analogue
120
0
0
0
X
 
 
20092
csp
81
0
0
0
X
 
 
20091
rsv analogue
76
0
0
0
X
 
 
20090
KAAAD
23
0
0
0
X
 
 
20089
nociceptin analogue
121
0
0
0
X
 
 
20088
nociceptin analogue
121
0
0
0
X
 
 
20087
nociceptin analogue
121
0
0
0
X
 
 
20086
nociceptin Antagonist
80
0
0
0
X
 
 
20085
SFT-L1
60
0
0
0
X
 
 
20084
Dirhodium complex
80
44
0
0
X
 
 
20082
Apelin-17
138
64
13
0
X
 
 
20081
complex BK-PGG
57
0
0
0
X
 
 
20080
hCGA(G364S)
120
0
0
0
X
 
 
20079
rhodopsin-jue11-complex
60
0
0
0
X
 
 
20078
HEDISTIN
124
0
0
0
X
 
 
20076
TC6b
122
0
0
0
X
 
 
20075
MeuTXKbeta1
145
0
0
0
X
 
 
20073
cyclo[Trp-D-Leu-1,5-sub-(1,2,3)-triazole-D-Ala-Aod]
15
0
0
0
X
 
 
20072
cyclo[Trp-Leu-1,5-sub-(1,2,3)-triazole-D-Ala-Aod]
30
0
0
0
X
 
 
20071
cyclo[Trp-Ile-1,4-sub-(1,2,3)-triazole-D-Ala-Aod]
15
0
0
0
X
 
 
20070
Cyclic Tetrapeptide 1
41
0
0
0
X
 
 
20069
Cyclic Tetrapeptide 1
44
0
0
0
X
 
 
20068
Cyclic Tetrapeptide 1
44
0
0
0
X
 
 
20067
Cyclic Tetrapeptide 1
42
0
0
0
X
 
 
20066
Cyclic Tetrapeptide 1
36
0
0
0
X
 
 
20065
Cyclic Tetrapeptide 1
35
0
0
0
X
 
 
20064
Cyclic Tetrapeptide 1
24
0
0
0
X
 
 
20063
Model Peptide
68
0
0
0
X
 
 
20062
Myelin Basic Protein
109
0
0
0
X
 
 
20061
GG8WF
47
0
0
0
X
 
 
20060
YI12FF
68
0
0
0
X
 
 
20059
YI12WY
72
0
0
0
X
 
 
20058
YI12WW
73
0
0
0
X
 
 
20057
YI12WF
69
0
0
0
X
 
 
20056
LSEAL-CaMLD complex
27
0
0
0
X
 
 
20055
KIA7H tetramer
105
22
0
0
X
 
 
20054
KIA7W tetramer
114
48
0
0
X
 
 
20053
Insulin A-chain variant peptide
101
46
0
0
X
 
 
20052
Human Insulin A-chain peptide
82
30
0
0
X
 
 
20051
Human Obestatin
117
0
0
0
X
 
 
20050
D-PAKKR monomer
39
0
0
0
X
 
 
20049
Mu-KIIIA[C1A,C9A]
88
15
12
0
X
 
 
20048
Mu-contoxin KIIIA
91
14
15
0
X
 
 
20047
fusionpeptide
67
0
0
0
X
 
 
20046
RAT IAPP-1-19
84
0
0
0
X
 
 
20045
HUMAN IAPP-1-19
82
0
0
0
X
 
 
20044
Interleukin-8 C-terminal domain
134
0
4
0
X
 
 
20043
Cyclic Pseudotetrapeptide
27
0
0
0
X
 
 
20042
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20041
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20040
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20039
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20038
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20037
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20036
Cyclic Pseudotetrapeptide
27
0
0
0
X
 
 
20034
4F
127
0
0
0
X
 
 
20033
dicarba-ImI
65
34
10
0
X
 
 
20032
GBAP
60
0
10
0
X
 
 
20031
Apelin 17
137
60
0
0
X
 
 
20030
Apelin 17
137
61
0
0
X
 
 
20029
Apelin 17
125
70
0
0
X
 
 
20028
Statherin
88
0
0
0
X
 
 
20027
brome mosaic virus protein 1a
86
57
17
0
X
 
 
20026
F protein
109
0
0
0
X
 
 
20023
SIIIA monomer
109
52
26
0
X
 
 
20022
metastin analog
55
0
0
0
X
 
 
20020
PND_LAI
99
0
0
0
X
 
 
20019
PND MN
86
0
0
0
X
 
 
20018
Temporin-SHc
82
52
0
0
X
 
 
20017
Temporin-SHb
84
51
0
0
X
 
 
20016
Temporin-SHa
81
48
0
0
X
 
 
20015
PND SF2
73
4
0
0
X
 
 
20014
CAPISTRUIN
96
0
0
0
X
 
 
20013
PFR peptide
76
0
0
0
X
 
 
20012
PFR peptide
76
0
0
0
X
 
 
20009
CLN025
62
0
0
0
X
 
 
20008
L7P Con-T
42
0
0
0
X
 
 
20007
Conopressin-T
42
0
0
0
X
 
 
20005
Leu-enkephalin
24
24
0
0
X
 
 
20004
Leu-enkephalin
24
24
0
0
X
 
 
20003
Leu-enkephalin
24
24
0
0
X
 
 
20002
RgIA
77
0
0
0
X
 
 
20001
odorranalectin
92
0
0
0
X
 
 
19998
sodium channel toxin Hd1a
204
138
38
0
X
 
 
19996
ROQ-Tnf
166
444
166
0
X
 
X
19994
protein YgaP from Escherichia coli
228
12
61
0
X
 
 
19992
Kelch domain
252
0
252
0
X
 
 
19991
iron-sulphur cluster
610
486
110
0
X
 
 
19989
N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1
488
225
74
0
X
 
 
19988
PR domain of FOG-1
606
474
109
0
X
 
 
19987
MIT1 domain of a chitin synthase
406
278
73
0
X
 
 
19986
Xenopus RecQ4 zinc knuckle
132
43
21
0
X
 
 
19984
BlLPMO10A
907
675
177
0
X
 
 
19982
NPM-N (Nucleophosmin) pentamer
122
300
122
0
X
 
 
19981
CnA-VIVIT
127
0
127
0
X
 
 
19980
CnA free
124
0
124
0
X
 
 
19979
B24G insulin
215
0
0
0
X
 
 
19978
[AibB8,LysB28,ProB29]-insulin analogue
292
0
0
0
X
 
 
19977
human HCN2 CNBD in the cAMP-unbound state
927
624
149
0
X
 
 
19974
BA42 protein
823
638
145
0
X
 
 
19973
potent antifungal peptide Cm-p5
77
46
11
0
X
 
 
19971
CupS
841
647
156
0
X
 
 
19970
Enterocin NKR-5-3B
263
154
62
0
X
 
 
19966
N-terminus of SOCS5
392
232
63
0
X
 
 
19963
Bitistatin_B
459
172
86
0
X
 
 
19962
Truncated L126Z-sod1
252
230
117
0
X
 
 
19961
SUMO Dimer in Complex with SIM2-3 from RNF4
765
484
113
0
X
 
 
19960
Human Chemokine CCL19
471
267
77
0
X
 
 
19959
Structural basis for binding of Pan3 to Pan2 and its function in mRNA recruitment and deadenylation
255
121
36
0
X
 
 
19958
N-terminal Domain of Enzyme I
137
0
279
0
X
 
 
19957
DNA-MC1
787
78
103
0
X
X
 
19955
tandem SH3 domain of CAP
830
551
132
0
X
 
 
19954
Nrd1p CID - Trf4p NIM complex
789
374
152
0
X
 
 
19953
V domain of RAGE in complex with IOR
529
345
92
0
X
 
 
19952
StAR D6
1143
878
201
0
X
 
 
19951
apoE(195-299)
188
306
94
0
X
 
 
19947
Bitistatin_A
463
201
77
0
X
 
 
19946
cytoplasmic rhodanese domain of the full-length inner membrane protein YgaP
554
303
112
0
X
 
 
19945
FldA in complex with flavin
927
739
184
0
X
 
 
19943
inner membrane protein YgaP
563
306
112
0
X
 
 
19942
terminal Ig-like domain from Leptospira interrogans LigB
451
368
91
0
X
 
 
19941
TM domain of LAMP-2A
177
159
37
0
X
 
 
19940
ompa
143
463
143
0
X
 
 
19939
MBD4 methyl-cytosine binding domain bound to methylated DNA
474
291
75
0
X
X
 
19938
putative thioredoxin (ECH_0218) in the oxidized state
578
352
117
0
X
 
 
19937
Dual-phosphorylated human p38 alpha ADP and MK2 334/D peptide bound
126
126
0
0
X
 
 
19936
Dual-phosphorylated human p38 alpha MK2 334/D peptide bound
145
145
0
0
X
 
 
19935
Dual-phosphorylated human p38 alpha ADP-bound
126
126
0
0
X
 
 
19934
p38_2P_apo
154
154
0
0
X
 
 
19933
novel human tachykinin Hemokinin-1 (hHK1)
46
0
0
0
X
 
 
19932
peptide ImI1
63
0
0
0
X
 
 
19931
DC-SIGN
122
364
122
0
X
 
 
19930
p38-0P apo
154
154
0
0
X
 
 
19929
HP24stab derived from the villin headpiece subdomain
145
79
24
0
X
 
 
19928
BamA-P4P5
813
654
175
0
X
 
 
19925
DNA dodecamer with A:C mismatch
72
0
0
0
 
X
 
19922
TDP-43 RRM2
69
221
69
0
X
 
 
19921
hIFABP-oleate complex
784
454
158
0
X
 
 
19917
DNA dodecamer containing the 5-hydroxycytosine
70
0
0
0
 
X
 
19916
cold shock protein, TaCsp with dT7
348
155
66
0
X
 
 
19915
cold shock protein, TaCsp
348
155
66
0
X
 
 
19914
KDM5B PHD1 finger in complex with H3K4me0(1-10aa)
338
165
51
0
X
 
 
19913
KDM5B PHD1 finger
258
189
51
0
X
 
 
19912
DNA duplex
142
0
0
0
 
X
 
19911
HP24wt derived from the villin headpiece subdomain
127
73
18
0
X
 
 
19910
P22S mutant of N-terminal CS domain of human Shq1
481
366
90
0
X
 
 
19906
EDB and specific binding aptide
549
328
104
0
X
 
 
19905
phosphorylated 4E-BP2 monomer
216
299
0
0
X
 
 
19904
PPIase domain of TbPar42
686
473
122
0
X
 
 
19902
P15 FLiPS
104
39
20
0
X
 
 
19901
Thymosin alpha 1
145
81
29
0
X
 
 
19893
Q4D059, a hypothetical protein from Trypanosoma cruzi
426
335
84
0
X
 
 
19892
OUTER MEMBRANE PROTEIN X IN NANODISC
118
0
117
0
X
 
 
19891
Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4
578
459
118
0
X
 
 
19890
CGACTAGTCG dimer
82
0
0
0
 
X
 
19889
CGACTAGTCG with AIK-18/51-1
96
0
0
0
 
X
 
19888
CGACGCGTCG with 5,6,7,8-TETRAHYDROBIOPTERIN
82
0
0
0
 
X
 
19887
Oligonucleotide Model of the MiR-21 Pre-Element
100
0
0
0
 
 
X
19886
CGACGCGTCG
98
0
0
0
 
X
 
19885
SENP1
273
609
215
0
X
 
 
19884
CcP
240
757
240
0
X
 
 
19883
peptoid analogue of maculatin G15 - peptoid trans-Nleu at position 13
107
60
0
0
X
 
 
19882
a peptoid analogue of maculatin G15 containing cis-Nleu at position 13
102
50
0
0
X
 
 
19881
transport protein m
520
370
90
0
X
 
 
19880
Copsin
302
161
67
0
X
 
 
19879
a computational designed protein based on structure template 1cy5
350
214
57
0
X
 
 
19878
Int-DLP
196
0
0
0
X
 
 
19876
YmoB. A modulator of biofilm formation
734
505
123
0
X
 
 
19875
Pyrin
194
297
93
0
X
 
 
19874
kalata B1[W23WW]
151
0
0
0
X
 
 
19873
D-arm of tRNA(Met)
110
94
0
0
 
 
X
19872
apo form of human glutaredoxin 5
523
484
118
0
X
 
 
19870
6aJL2 Amyloidogenic Light Chain Protein
538
384
98
0
X
 
 
19869
ZapA homodimer
463
266
74
0
X
 
 
19866
AbpA
884
687
170
0
X
 
 
19865
LASSO PEPTIDE BASED INTEGRIN INHIBITOR: MICROCIN J25 VARIANT WITH RGDF SUBSTITUTION OF GLY12-ILE13-GLY14-THR15
116
0
0
0
X
 
 
19863
AG(7-deaza)G FAPY modified duplex
128
0
0
0
 
X
 
19862
AGC FAPY modified duplex Major isomer
133
0
0
0
 
X
 
19861
AGT FAPY Modified duplex
140
0
0
0
 
X
 
19860
a ribosomal protein
487
360
83
0
X
 
 
19859
GK cecropin-like peptide
196
53
27
0
X
 
 
19858
Phosphorylated Mengovirus Leader Protein
160
161
69
0
X
 
 
19857
Phosphorylated Mengovirus Leader Protein
159
159
69
0
X
 
 
19856
a peptoid analogue of maculatin G15 in DPC micelles
112
68
0
0
X
 
 
19855
Mengovirus Leader Protein Bound to Ran GTPase
160
159
70
0
X
 
 
19854
Mengovirus Leader Protein Bound to Ran GTPase
1150
899
294
0
X
 
 
19853
AGA modified
161
0
0
0
 
X
 
19852
NUCLEOTIDE-FREE HUMAN RAN GTPASE
1137
874
294
0
X
 
 
19851
Unknown protein YP_001712342.1 from Acinetobacter baumannii
642
362
115
0
X
 
 
19850
GrxS14-BolA2 apo-heterodimer from Arabidopsis thaliana
178
0
178
0
X
 
 
19849
reduced BolA2 from Arabidopsis thaliana
385
244
95
0
X
 
 
19848
PA3793 from Pseudomonas aeruginosa
607
462
120
0
X
 
 
19847
alpha amylase inhibitor peptide aS1 from Allatide scholaris
167
0
1
0
X
 
 
19846
alpha-amylase inhibitor peptide aS4 from Allatide scholaris
167
0
0
0
X
 
 
19845
Coronavirus Envelope Proteins-1
337
260
63
0
X
 
 
19844
RNase 4
110
210
110
0
X
 
 
19843
ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholate
752
541
139
0
X
 
 
19841
Ptr ToxB
338
192
69
0
X
 
 
19840
ToxB
320
186
62
0
X
 
 
19837
E. coli Trigger Factor in complex with unfolded PhoA365-471
882
445
345
0
X
 
 
19836
E. coli Trigger Factor in complex with unfolded PhoA1-150
1154
565
479
0
X
 
 
19835
E. coli Trigger Factor in complex with unfolded PhoA220-310
1065
481
444
0
X
 
 
19834
New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein
939
727
215
0
X
 
 
19833
antimicrobial peptide LsbB
196
92
31
0
X
 
 
19832
antimicrobial peptide LsbB
194
98
28
0
X
 
 
19830
reduced Jaburetox
405
297
84
0
X
 
 
19829
CHEMOKINE (C-C MOTIF) RECEPTOR 2
96
39
14
0
X
 
 
19828
CHEMOKINE (C-C MOTIF) RECEPTOR 2
110
71
14
0
X
 
 
19826
sortase A from S. aureus in complex with benzo[d]isothiazol-3-one based inhibitor
883
660
148
0
X
 
 
19824
Solution structure of a TrkAIg2 domain construct for use in drug discovery
574
441
113
0
X
 
 
19823
Lasso Peptide Caulonodin V
100
0
0
0
X
 
 
19822
B25-(alpha, beta)-dehydro-phenylalanine insulin
277
138
39
0
X
 
 
19821
Stf76 from the Sulfolobus islandicus plasmid-virus pSSVx
338
77
77
0
X
 
 
19819
cyanometNgb
290
425
136
0
X
 
 
19818
metNgb
299
427
140
0
X
 
 
19817
mutation G159D in troponin C bound to the anchoring region of troponin I
370
219
75
0
X
 
 
19816
C-domain of troponin C bound to the anchoring region of troponin I
331
216
70
0
X
 
 
19815
COILED COIL DOMAIN OF Protein phosphatase 1 regulatory subunit 12A
298
206
50
0
X
 
 
19813
BmKTX-D19K/K6D
216
0
0
0
X
 
 
19811
a computational designed protein based on template of human erythrocytic ubiquitin
445
264
76
0
X
 
 
19810
BmKTX-D19K
222
0
0
0
X
 
 
19809
YSCUCN in a micellar complex with SDS
95
55
55
0
X
 
 
19808
Ginsentide
150
0
0
0
X
 
 
19807
NMR structure of hypothetical protein ZP_02069618.1 from Bacteroides uniformis ATCC 8492.
887
496
157
0
X
 
 
19806
hypothetical protein ZP_02064002.1 from Bacteroides ovatus ATCC 8483
896
497
158
0
X
 
 
19801
monomer1
782
577
146
0
X
 
 
19800
PrgK first periplasmic domain
328
250
57
0
X
 
 
19799
LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalis
297
230
59
0
X
 
 
19798
6aJL2-R24G Amyloidogenic Light Chain Protein
577
392
104
0
X
 
 
19797
NA,K-ATPASE REGULATORY PROTEIN FXYD2b
225
169
60
0
X
 
 
19796
hinge monomer
63
174
61
0
X
 
 
19792
RBMX
491
366
92
0
X
 
 
19791
Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIH
724
441
121
0
X
 
 
19789
N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin I
296
94
82
0
X
 
 
19788
FKBP52
111
341
111
0
X
 
 
19787
FKBP51
250
351
114
0
X
 
 
19784
G-triplex truncated-TBA
119
66
0
9
 
X
 
19783
fourth constant immunoglobulin domain of nurse shark IgNAR
578
394
97
0
X
 
 
19779
Solution structure of the SGTA N-terminal domain
395
303
73
0
X
 
 
19778
CPEB1RRM12 in complex with RNA
692
373
194
0
X
 
X
19777
CPEB4RRM12 in free state
886
463
181
0
X
 
 
19776
CPEB4RRM12 in complex with RNA
955
521
177
0
X
 
X
19775
CPEB1RRM12
1040
563
212
0
X
 
 
19774
tandem UIMs of wild-type RAP80
104
152
55
0
X
 
 
19773
E81 deletion mutant from RAP80 tandem UIMs
114
113
58
0
X
 
 
19771
CPEB1ZZ
306
173
59
0
X
 
 
19769
Z-L2LBT variant A
61
161
61
0
X
 
 
19768
hDkk4
882
683
185
0
X
 
 
19766
Heterotrimeric pre-mRNA Retention and Splicing Complex
1026
705
180
0
X
 
 
19765
gbvb5
149
0
0
0
X
 
 
19764
dimeric transmembrane domain of Toll-like receptor 3
224
168
34
0
X
 
 
19763
MS1
207
0
207
0
X
 
 
19759
Tetra-O-GalNAc glycosylated mucin sequence from alpha dystroglycan mucin domain
101
62
10
0
X
 
 
19758
RPAP3
758
537
132
0
X
 
 
19757
RPAP3
715
501
126
0
X
 
 
19755
MecA
528
409
90
0
X
 
 
19753
Plectin repeat domain 6
335
662
195
0
X
 
 
19752
LysGH15
739
560
136
0
X
 
 
19751
ORF2
646
416
119
0
X
 
 
19750
gp41 ectodomain monomer on a DPC micelle
125
195
68
0
X
 
 
19749
N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1)
572
427
112
0
X
 
 
19748
Lactodifucotetraose (LDFT) beta anomer
30
24
0
0
 
 
 
19746
synthetic Mamba-1 peptide
236
0
0
0
X
 
 
19745
DNA (28-MER)
212
0
0
0
 
X
 
19744
Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase
235
486
235
0
X
 
 
19743
Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase
300
486
236
0
X
 
 
19742
Dimethylarginine Dimethylaminohydrolase
235
486
235
0
X
 
 
19741
p75-TM-C257A
220
125
42
0
X
 
 
19740
CYP101
306
960
297
0
X
 
 
19739
Calcium Bound S100P - V Domain of RAGE complex
373
214
81
0
X
 
 
19738
second bromodomain of Brd4 with Di-acetylated Twist peptide
754
454
118
0
X
 
 
19737
C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)
899
472
194
0
X
 
 
19736
1-C-Grx1
735
594
132
0
X
 
 
19735
TIA-1 RRM2,3 monomer
1073
767
198
0
X
 
 
19733
trimeric Skp
14
14
0
0
X
 
 
19732
NLRC5 caspase recruitment domain (CARD)
576
429
99
0
X
 
 
19731
peptidyl-tRNA hyrolase from Vibrio cholerae
1053
826
182
0
X
 
 
19730
trimeric Skp with bound tOmpA
13
13
0
0
X
 
 
19729
HEN EGG BETA-DEFENSIN GALLIN (CHICKEN OVO-DEFENSIN)
253
0
0
0
X
 
 
19728
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
112
0
0
0
 
X
 
19727
HIFABP Ketorolac complex
694
434
126
0
X
 
 
19726
GLD-1 KH-QUA2 bound to 5'-CUACUCAUAU-3'
856
386
144
0
X
 
X
19725
Ig-alpha YE variant Ig-beta construct
188
0
95
0
X
 
 
19724
Ig-alpha Ig-beta construct
249
119
83
0
X
 
 
19723
Ig-alpha Ig-beta construct
187
236
95
0
X
 
 
19722
H83A apo HasAp
154
163
154
0
X
 
 
19721
Y75A apo HasAp
149
164
149
0
X
 
 
19720
WT apo HasAp
164
173
164
0
X
 
 
19719
PFI1780w-PHIST
404
419
148
0
X
 
 
19718
Yah1 reduced
362
347
83
0
X
 
 
19717
Yah1 Oxidized
386
398
100
0
X
 
 
19716
Zn-binding domain of eukaryotic translation initiation factor 3, subunit G
130
78
24
0
X
 
 
19715
Receiver domain of ethylene receptor ETR1
686
539
136
0
X
 
 
19714
Transport protein A
520
378
90
0
X
 
 
19713
Domain-Swapped GLPG
343
193
69
0
X
 
 
19712
Designed Exendin-4 analogues
222
0
0
0
X
 
 
19711
native split Npu DnaE intein
713
536
136
0
X
 
 
19710
CDYL2 chromodomain
322
232
54
0
X
 
 
19709
HR8998C
794
584
147
0
X
 
 
19708
VSD-Q1
137
278
137
0
X
 
 
19707
extracellular sensor domain of DraK histidine kinase
499
361
93
0
X
 
 
19704
Neurotoxin II from snake venom Naja Oxiana
380
282
83
0
X
 
 
19703
Iron-sulfur cluster binding protein from Ehrlichia chaffeensis
465
393
98
0
X
 
 
19702
dimerization domain of the human polyoma, JC virus agnoprotein
218
0
0
0
X
 
 
19701
soluble A 17-34 peptide
84
0
0
0
X
 
 
19700
P33A mutant of non-conventional toxin WTX from Naja kaouthia
414
0
74
0
X
 
 
19699
m04/gp34 mouse Cytomegalovirus Immunoevasin core domain
143
411
143
0
X
 
 
19698
preQ1 Class II riboswitch from Streptococcus pneumoniae
345
245
20
0
 
 
X
19697
novel venom peptide toxin from sample limited terebrid marine snail
97
46
0
0
X
 
 
19696
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
154
0
0
0
 
X
 
19695
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
151
0
0
0
 
X
 
19694
FHL2 LIM adaptor and its Interaction with Ski
535
303
101
0
X
 
 
19693
oxidized dimeric form of human defensin 5
334
236
62
0
X
 
 
19692
Divalent Cations at the Active Site of the Neurospora VS Ribozyme
232
173
91
0
 
 
X
19689
SiCYS
1125
788
201
0
X
 
 
19688
Tah1Pih1
673
490
105
0
X
 
 
19687
immune signalling subunit
695
408
144
0
X
 
 
19686
ASD-1+RNA
87
185
87
0
X
 
X
19685
RRM3 intermediate state
490
396
107
0
X
 
 
19684
HR9129A
373
270
66
0
X
 
 
19683
S-linked glycopeptide sublancin 168
184
65
42
0
X
 
 
19682
Zinc finger-PHD-type 1 domain_number-1
530
392
95
0
X
 
 
19681
E. coli LpoB
953
756
197
0
X
 
 
19680
ASD-1
171
277
86
0
X
 
 
19679
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7
68
39
9
0
X
 
 
19678
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5
61
32
13
0
X
 
 
19677
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4
53
23
11
0
X
 
 
19675
CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44
61
29
10
0
X
 
 
19674
CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10
62
38
11
0
X
 
 
19673
p75 transmembrane domain
233
170
42
0
X
 
 
19672
Dok1 PTB domain monomer
181
95
86
0
X
 
 
19671
3rC34Y
390
273
91
0
X
 
 
19670
lysine-free (K0) ubiquitin
254
219
70
0
X
 
 
19669
Ms-NbGRP2 monomer
103
190
103
0
X
 
 
19668
a3Y monomer
435
309
65
0
X
 
 
19667
carboxyterminal domain of NusG
356
263
60
0
X
 
 
19666
DC1A
342
245
60
0
X
 
 
19663
Somatostatin-14
66
0
0
0
X
 
 
19662
I-V kissing-loop interaction of the Neurospora VS ribozyme
231
186
67
0
 
 
X
19661
SHB modified duplex
198
0
0
0
 
X
 
19660
pmf-g
302
171
56
0
X
 
 
19659
RHB Modified duplex
201
0
0
0
 
X
 
19658
maximin-4
144
0
0
0
X
 
 
19657
Penicillium Antifungal Protein PAF
303
203
59
0
X
 
 
19656
CD79b cytosolic domain phosphorylated
47
138
47
0
X
 
 
19655
CD79b cytosolic domain phosphorylated
48
139
48
0
X
 
 
19654
human Mcl-1
965
548
175
0
X
 
 
19653
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
633
420
99
0
X
X
 
19651
CD79b cytosolic domain denatured
48
139
48
0
X
 
 
19650
CD79b cytosolic domain
48
139
48
0
X
 
 
19649
CD79a cytosolic domain phosphorylated
60
173
60
0
X
 
 
19648
CD79a cytosolic domain phosphorylated
60
172
60
0
X
 
 
19646
major factor VIII binding region on von Willebrand factor
501
287
85
0
X
 
 
19645
CD79a cytosolic domain
60
173
60
0
X
 
 
19644
CD79a cytosolic domain
59
170
59
0
X
 
 
19643
5-Hydroxytryptamine Receptor 2a and 2c Variants with PSD-95 and SAP997
531
296
90
0
X
 
 
19642
RBM39_RRM1
523
385
95
0
X
 
 
19641
3rCWP7D
467
322
107
0
X
 
 
19638
cytochrome c Y67H
573
0
0
0
X
 
 
19637
Outer Membrane Protein X from E. coli
177
470
177
0
X
 
 
19635
Pseudomonas aeruginosa Tps4 two-partner secretion system
499
388
83
0
X
 
 
19634
CR4/5 domain of medaka telomerase RNA
463
335
65
0
 
 
X
19633
EF-hand domain from sea urchin polycystin-2
504
386
104
0
X
 
 
19632
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
446
241
73
0
X
 
 
19629
Cyanobacterial GAF domain
213
357
132
0
X
 
 
19628
protein NP_419126.1 from CAULOBACTER CRESCENTUS
409
302
74
0
X
 
 
19627
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
665
380
113
0
X
 
 
19626
rsahit
810
596
149
0
X
 
 
19625
TNPX
704
494
130
0
X
 
 
19624
circular sortase A
772
0
159
0
X
 
 
19623
GA-79-MBP cs-rosetta structures
112
162
55
0
X
 
 
19622
PetF monomer
479
371
88
0
X
 
 
19621
CNBHD
683
554
137
0
X
 
 
19620
DNA duplex containing N3T-ethylene-N1I
120
0
0
0
 
X
 
19619
lantibiotic NAI-107
104
40
0
0
X
 
 
19618
transport protein
603
469
116
0
X
 
 
19617
Big domain from Leptospira interrogans
366
248
92
0
X
 
 
19616
Dimethylarginine Dimethylaminohydrolase
238
486
237
0
X
 
 
19615
PaDDAH_TM
239
481
235
0
X
 
 
19614
basic-helix-loop-helix region of the transcriptional repressor HES-1
828
604
142
0
X
 
 
19613
HOP2
411
310
82
0
X
 
 
19611
Enzymatic cyclisation of kalata B1 using sortase A
156
74
0
0
X
 
 
19610
p300 Taz2:ETAD1 complex
721
558
134
0
X
 
 
19609
Protein-RNA Ternary Complex
987
575
184
0
X
 
X
19608
mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195
952
738
169
0
X
 
 
19607
C-terminal domain of SRA1p
645
536
130
0
X
 
 
19606
UBA Domain of Human NBR1
290
176
50
0
X
 
 
19605
PASTA domain of PonA2
324
245
61
0
X
 
 
19604
complex of calmodulin with minimal binding domain from HIV-1 matrix protein
1059
632
197
0
X
 
 
19603
ctrdpc
96
0
0
0
X
 
 
19602
dimer of the metal binding domain 1-16 of human amyloid beta-peptide in complex with Zinc
105
56
16
0
X
 
 
19601
CXCL5
218
138
70
0
X
 
 
19600
CEH37 Homeodomain
375
199
64
0
X
 
 
19599
hman EPRS R12 repeats
711
520
136
0
X
 
 
19598
WHEP repeats
1072
768
211
0
X
 
 
19597
Ctrr_sds
98
0
0
0
X
 
 
19596
pdx1c
272
261
74
0
X
 
 
19595
oxytocin
52
24
0
0
X
 
 
19594
G-quadruplex bound to the bisquinolinium compound Phen-DC3
194
0
0
0
 
X
 
19593
Truncated EGF-A
136
62
0
0
X
 
 
19592
Molecular Binding of TFF1 Estrogen Response Element
287
0
0
0
 
X
 
19589
RhoGAP
1167
853
210
0
X
 
 
19587
alpha-conotoxin Vc1.1: [3,16]-trans dicarba Vc1.1
30
31
11
0
X
 
 
19586
Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495
829
397
145
0
X
 
 
19585
computational designed dimer based on the engrailed homeodomain structure
374
260
63
0
X
 
 
19584
Dvl-2 DEP
92
274
92
0
X
 
 
19583
peptide derived from the membrane proximal external region of HIV-1 gp41
203
20
0
0
X
 
 
19582
peptide derived from the membrane proximal external region of HIV-1 gp41
203
87
0
0
X
 
 
19581
peptide derived from the trans-membrane region of HIV-1 gp41
179
94
0
0
X
 
 
19580
PAP262-270 in SDS micelles
60
0
0
0
X
 
 
19579
C-terminal domain from A. ventricosus minor ampullate spidroin (MiSp)
571
463
130
0
X
 
 
19578
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-trans dicarba Vc1.1
30
31
11
0
X
 
 
19577
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-cis dicarba Vc1.1
30
31
13
0
X
 
 
19576
FAPP1 PH domain monomer
97
274
97
0
X
 
 
19573
XANTHOMONIN II
67
0
0
0
X
 
 
19572
quadruplex d(TGGGTTTGGGTTGGGTTTGGG)
180
0
0
0
 
X
 
19571
d(GGGTTTTGGGTGGGTTTTGGG) quadruplex
176
0
0
0
 
X
 
19570
cactus-derived antimicrobial peptide Ep-AMP1
186
62
0
0
X
 
 
19569
Vps28C
582
433
105
0
X
 
 
19568
ISUR
98
136
46
0
X
 
 
19567
DHFR
262
418
172
0
X
 
 
19566
DHFR
262
275
167
0
X
 
 
19565
DHFR
260
260
170
0
X
 
 
19564
DHFR
267
275
170
0
X
 
 
19563
DHFR
168
180
168
0
X
 
 
19562
FRS2a PTB domain with neurotrophin receptor TrkB
720
419
134
0
X
 
 
19561
Taf-RRM-RanBP
146
414
146
0
X
 
 
19560
Middle domain of Hsp90alpha
404
1181
404
0
X
 
 
19559
MS1
126
237
126
0
X
 
 
19558
Crc
318
825
235
0
X
 
 
19557
circular g-domain analog from the wheat metallothionein Ec-1
114
0
0
0
X
 
 
19556
C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1
67
25
14
0
X
 
 
19555
C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11
58
26
12
0
X
 
 
19554
Domain 2 of E. coli ribosomal protein S1
870
668
174
0
X
 
 
19553
Blo 1 12 CBD domain
392
292
66
0
X
 
 
19552
Blo t 19, a minor dust mite allergen from Blomia tropicalis
357
253
77
0
X
 
 
19551
hFKBP25 monomer
1394
945
229
0
X
 
 
19550
S1F1
533
389
95
0
X
 
 
19549
RsmZ(36-44)/RsmE(dimer) 2:1 complex
437
274
70
0
X
 
X
19548
RsmZ(SL4)/RsmE(dimer) 2:1 complex
543
355
81
0
X
 
X
19547
RsmZ(SL3)/RsmE(dimer) 2:1 complex
533
346
76
0
X
 
X
19546
RsmZ(SL2)/RsmE(dimer) 2:1 complex
528
346
78
0
X
 
X
19545
cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03
190
132
17
0
 
 
X
19544
RsmZ(SL1)/RsmE(dimer) 2:1 complex
552
360
78
0
X
 
X
19542
Mambalgin-2
329
143
58
0
X
 
 
19541
Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39
621
290
104
0
X
 
 
19540
MyT1 F4F5 - DNA complex
51
115
51
0
X
X
 
19539
acp5b
473
357
93
0
X
 
 
19538
IMS DOMAIN OF THE MITOCHONDRIAL IMPORT PROTEIN TIM21 FROM S. CEREVISIAE
792
451
129
0
X
 
 
19536
acp5a
463
364
88
0
X
 
 
19535
SGTX-Sf1a
255
182
49
0
X
 
 
19534
non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complex
140
120
20
0
X
 
X
19533
NusE (S10) from Thermotoga maritima
418
316
68
0
X
 
 
19532
mutant dimeric TM domain of VEGFR2 receptor
236
182
44
0
X
 
 
19531
trimeric mutant TM domain of VEGFR2 receptor
236
171
44
0
X
 
 
19530
BLM RQC
660
324
120
0
X
 
 
19528
DOUBLE GS-TAMAPIN MUTATION R6A R7A
174
0
0
0
X
 
 
19527
GS-TAMAPIN MUTATION R13A
177
0
0
0
X
 
 
19526
SLED domain of Scml2
635
468
115
0
X
 
 
19525
Solution structure of the Nt. GR-RBP1 RRM domain
479
362
93
0
X
 
 
19524
GS-TAMAPIN MUTATION R7A
183
0
0
0
X
 
 
19523
N-terminal domain of Bilbo1 from Trypanosoma brucei
493
409
107
0
X
 
 
19522
Complex Between BCL-xL and the p53 Core Domain
273
646
209
0
X
 
 
19521
BCL-xL containing the alpha1-alpha2 disordered loop
865
642
209
0
X
 
 
19520
BCL-xL in its p53-bound conformation
273
646
209
0
X
 
 
19519
GS-TAMAPIN MUTATION R6A
180
0
0
0
X
 
 
19518
RLC/MyBS
1148
788
203
0
X
 
 
19517
E1TM
33
91
33
0
X
 
 
19516
Dot1L-AF9 complex
522
414
89
0
X
 
 
19515
MPER-PB7
193
145
31
0
X
 
 
19514
MPER-Du151
192
112
34
0
X
 
 
19513
MPER-Con089
189
112
32
0
X
 
 
19512
MPER-HxB2-AA
187
142
32
0
X
 
 
19511
homeodomain transcription factor Gbx1
425
248
75
0
X
X
 
19510
Z-subunit
510
381
103
0
X
 
 
19508
human wild type FAPP1-PH domain
570
400
113
0
X
 
 
19507
CFP10 Monomer
109
317
109
0
X
 
 
19506
Human eRF1
305
516
299
0
X
 
 
19505
WW Domain Strand-Swapped Dimer
182
0
0
0
X
 
 
19504
baa38
248
0
0
0
X
 
 
19503
WW Domain with Loop 1 Excised
211
0
0
0
X
 
 
19502
dsRBD3
514
284
93
0
X
 
 
19501
Novel 4/7-Conotoxin LvIA
73
40
0
0
X
 
 
19500
HUR RRM3
224
311
110
0
X
 
 
19499
HUR RRM3
246
297
118
0
X
 
 
19498
bacteriophage T7 encoded inhibitor (gp1.2)
406
266
75
0
X
 
 
19497
Ca free domain 6 of villin
372
321
100
0
X
 
 
19496
FLNa3-5
398
670
258
0
X
 
 
19495
FLNc4-5
265
495
169
0
X
 
 
19494
HUR RRM3
184
204
109
0
X
 
 
19493
purotoxin-2
351
0
0
0
X
 
 
19491
Galectin-3
1467
1260
336
0
X
 
 
19490
cdN dimer
188
565
188
0
X
 
 
19489
MSP-P56S DOMAIN/VAPB
522
230
118
0
X
 
 
19488
WW domain with polyproline stretch (PP2WW) of HYPB
208
150
46
0
X
 
 
19487
PP2WW mutant (KPP2WW) of HYPB
221
174
49
0
X
 
 
19486
Hr7298f
291
212
51
0
X
 
 
19485
SVIP mutation
411
280
67
0
X
 
 
19484
tm67
295
0
0
0
X
 
 
19483
WW domain of HYPB
190
147
44
0
X
 
 
19482
Regulatory Domain of Tyrosine Hydroxylase
460
358
88
0
X
 
 
19481
RDTH dimer
127
223
127
0
X
 
 
19480
RDTH dimer
123
217
123
0
X
 
 
19479
Active Site Mutant Pepitdyl Carrier Protein
482
292
79
0
X
 
 
19478
TNRC6Bm1
73
139
73
0
X
 
 
19477
P130Cas SD
238
0
238
0
X
 
 
19476
CONOTOXIN LO1A
95
48
0
0
X
 
 
19474
uninhibited ETV6 ETS domain
632
349
101
0
X
 
 
19473
Sp140 PHD finger cis conformer
318
159
53
0
X
 
 
19472
Sp140 PHD finger trans conformer
313
159
52
0
X
 
 
19471
WG12_LPS
61
0
0
0
X
 
 
19470
KR8_LPS
35
0
0
0
X
 
 
19469
WK10_LPS
55
0
0
0
X
 
 
19468
WR17_LPS
90
0
0
0
X
 
 
19464
HicA
285
176
50
0
X
 
 
19463
p87m-HlyIIc
571
377
112
0
X
 
 
19462
HlyIIC-Trans
261
193
59
0
X
 
 
19461
HlyIIC-Cis
555
371
113
0
X
 
 
19460
ShK-like immunomodulatory peptide from Ancylostoma caninum
275
196
56
0
X
 
 
19459
Recombinant CR1 fragment, domains 1-2
623
518
121
0
X
 
 
19458
Recombinant CR1 fragment, domains 2-3
249
152
67
0
X
 
 
19453
SP17945A
600
325
108
0
X
 
 
19452
putative thioredoxin (ECH_0218) in the reduced state from Ehrlichia chaffeensis
512
410
109
0
X
 
 
19451
PNUTS
64
114
64
0
X
 
 
19450
ShK-like immunomodulatory peptide from Brugia malayi
196
118
40
0
X
 
 
19449
BolA-like hypothetical protein RP812
403
320
80
0
X
 
 
19448
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
196
0
0
0
 
X
 
19447
Ubiquitin Binding with SH3 domains
132
0
132
0
X
 
 
19446
SSB
810
701
178
0
X
 
 
19444
murine norovirus CR6 NS1/2 protein
317
109
52
0
X
 
 
19443
EC1
117
311
117
0
X
 
 
19442
E7 dimer
39
126
42
0
X
 
 
19441
spermine modified DNA duplex
141
0
0
14
 
X
 
19440
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
136
0
0
14
 
X
 
19439
murine norovirus NS1/2 CW3 WT
305
108
51
0
X
 
 
19438
Tgam
295
417
136
0
X
 
 
19437
mammalian tachykinin neuropeptide gamma
91
0
0
0
X
 
 
19436
murine norovirus NS1/2 D94E mutant
453
307
75
0
X
 
 
19435
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
196
0
0
0
 
X
 
19433
YP_002937094.1
581
339
112
0
X
 
 
19432
Cat r 1
781
507
166
0
X
 
 
19431
hypothetical protein
693
398
121
0
X
 
 
19429
bacteriophage transcription regulator complex with p7 peptide
386
289
66
0
X
 
 
19428
entity
357
272
64
0
X
 
 
19427
BldD-CTD monomer
489
368
88
0
X
 
 
19426
kv14_pep61
271
210
56
0
X
 
 
19425
mouse RyR2 domain A
185
541
185
0
X
 
 
19424
RyR2A delta exon 3
145
276
145
0
X
 
 
19423
Vav1 SH2 domain complex
563
315
92
0
X
 
 
19422
Nosiheptide in Complex with TipAS
859
600
153
0
X
 
 
19421
Promothiocin A in Complex with TipAS
850
600
157
0
X
 
 
19419
C-Ala domain of alanyl-tRNA synthetase
718
530
130
0
X
 
 
19417
PaDsbA
1009
591
176
0
X
 
 
19416
Rrp7 C-terminal Domain
318
218
49
0
X
 
 
19415
LMO4-LIM2 in complex with DEAF-1 (404-418)
522
354
103
0
X
 
 
19414
PaDsbA
51
42
0
0
X
 
 
19413
KpDsbA
1016
596
185
0
X
 
 
19412
K11-linked Diubiquitin
138
0
138
0
X
 
 
19411
OmpX within the trimeric chaperone Skp
129
236
129
0
X
 
 
19410
tOmpA within the tirmeric chaperone Skp
167
424
167
0
X
 
 
19409
Trimeric Skp with bound tOmpA
147
0
147
0
X
 
 
19408
trimeric Skp with bound OmpX
149
283
149
0
X
 
 
19407
trimeric Skp
133
257
133
0
X
 
 
19406
K11-linked Diubiquitin
140
0
140
0
X
 
 
19404
OR33_cns
694
504
110
0
X
 
 
19403
Clip-segment of the von Willebrand domain 1 of Crossveinless 2
347
195
63
0
X
 
 
19402
antiparallel (2+2) G-quadruplex
229
0
0
0
 
X
 
19400
The structure of the Box CD enzyme reveals regulation of rRNA methylation
0
0
0
0
X
 
X
19399
EKLF(22-40)/Ubiquitin Complex
583
339
101
0
X
 
 
19398
Forkhead DNA binding domain of Brugia malayi DAF-16a
609
423
109
0
X
 
 
19397
FAT10 first domain
238
0
52
0
X
 
 
19396
Lasiocepsin
180
90
25
0
X
 
 
19395
human holo-PRL-3 in complex with vanadate
761
427
130
0
X
 
 
19394
human Polymerase iota UBM1-Ubiquitin Complex
1045
582
184
0
X
 
 
19392
CARMA1/Bcl10/MALT1 Signalosome: Nucleation Induced Filamentous Assembly
637
466
116
0
X
 
 
19391
MBD3
391
309
68
0
X
X
 
19390
EBNA-2 N-terminal Dimerization (END) domain
337
211
54
0
X
 
 
19389
stacked dimeric G-quadruplex
134
0
0
0
 
X
 
19387
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
240
0
0
23
 
X
 
19386
parallel-stranded G-quadruplex in DNA poly-G stretches
164
0
0
0
 
X
 
19385
conotoxin muPIIIA-2
141
0
0
0
X
 
 
19384
conotoxin muPIIIA-1
127
0
0
0
X
 
 
19383
Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2
281
190
47
0
X
 
 
19382
hnRNP G RRM in complex with the RNA 5'-AUCAAA-3'
604
293
97
0
X
 
X
19381
DNA/RNA (5'-D(*TP*TP*G)-R(P*(LG))-D(P*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')
186
0
0
0
 
X
 
19380
RNAP_alpha_subunit_CTD
626
340
112
0
X
 
 
19379
alpha7 nAChR transmembrane domain
534
473
128
0
X
 
 
19377
IL10 dimer
214
457
152
0
X
 
 
19376
Calmodulin, C-terminal domain
434
319
78
0
X
 
 
19375
N2-dG IQ at G3 in NarI sequence
213
0
0
0
 
X
 
19374
alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosa
166
0
0
0
X
 
 
19372
Ani s 5 Anisakis simplex allergen
694
418
125
0
X
 
 
19371
calbindin D9k magnesium bound-form
69
212
69
0
X
 
 
19370
calbindin D9k calcium bound-form
69
218
69
0
X
 
 
19369
calbindin D9k Apo-form
71
219
71
0
X
 
 
19368
Structure of Pex14 in complex with Pex5 LVxEF motif
409
212
62
0
X
 
 
19367
complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA
560
317
103
0
X
X
 
19366
region 2 of E. coli sigmaE
572
334
108
0
X
 
 
19365
Lipid Transfer Protein from Lentil Lens Culinaris
503
271
97
0
X
 
 
19364
Nupr1
78
247
86
0
X
 
 
19363
STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains
617
425
105
0
X
 
 
19362
STIM1 CC1-CC2 homodimer
485
357
78
0
X
 
 
19358
Val66 BDNF Prodomain
85
263
85
0
X
 
 
19357
Met66 BDNF Prodomain
85
264
85
0
X
 
 
19356
MS6
413
274
91
0
X
 
 
19355
Lassomycin
91
55
19
0
X
 
 
19354
Smoothened
798
556
125
0
X
 
 
19353
AS69_ASyn
620
450
113
0
X
 
 
19351
acetylated aSyn A53T monomer
133
400
133
0
X
 
 
19350
acetylated aSyn monomer
133
398
133
0
X
 
 
19349
aSyn mouse_T53A&N87S monomer
122
382
122
0
X
 
 
19348
aSyn mouse_N87S monomer
128
389
128
0
X
 
 
19347
aSyn_mouse_T53A
126
389
126
0
X
 
 
19346
aSyn_mouse
128
388
128
0
X
 
 
19345
aSyn_A53T&S87N
123
386
123
0
X
 
 
19344
aSyn_S87N
128
397
128
0
X
 
 
19343
OPA60 FROM N. GONORRHOEAE
106
316
106
0
X
 
 
19342
Transmembrane-cytosolic part of Trop2
175
79
25
0
X
 
 
19340
C-Terminal Domain of AciniformSpidroin
575
330
121
0
X
 
 
19338
aSyn A53T monomer
126
385
126
0
X
 
 
19337
aSyn
128
395
128
0
X
 
 
19336
5P12-RANTES-E66S
63
172
66
0
X
 
 
19335
5P12-RANTES-E66S
63
184
68
0
X
 
 
19334
Temporin-1 Ta in lipopolysaccharide micelles
56
0
0
0
X
 
 
19333
HIV-1 Vif SOCS-box with Elongin BC
250
417
160
0
X
 
 
19332
p15(PAF)
225
422
107
0
X
 
 
19331
HR7992A
375
265
76
0
X
 
 
19330
DUSP16 Monomer
123
379
123
0
X
 
 
19329
HR8700A
359
268
68
0
X
 
 
19328
HR7375C
340
251
62
0
X
 
 
19327
yahO
431
318
75
0
X
 
 
19325
26S proteasome subunit monomer
1086
811
208
0
X
 
 
19324
FKBP12.6
217
307
98
0
X
 
 
19323
FKBP12.6
218
307
98
0
X
 
 
19322
LTBP1-cb14TB3
459
0
236
0
X
 
 
19321
cerato populin
704
528
135
0
X
 
 
19320
Taf15
547
412
100
0
X
 
 
19319
RasGRP2 EF hands bound to calcium
326
303
77
0
X
 
 
19318
drSTIL
112
172
50
0
X
 
 
19317
DNA helicase RecQ
415
283
70
0
X
 
 
19315
HHARI Catalytic Domain
380
222
87
0
X
 
 
19314
HR9151A
601
453
98
0
X
 
 
19312
hr4784b
331
253
62
0
X
 
 
19311
Saccharomyces cerevisiae Est3 protein
218
568
151
0
X
 
 
19309
complex between the amyloid beta peptide (1-40) and the polyphenol epsilon-viniferin glucoside
220
0
0
0
X
 
 
19308
UVI31+
106
321
106
0
X
 
 
19307
UVI31+Mg
106
321
106
0
X
 
 
19306
an inhibitor bound dengue NS3 protease
369
712
217
0
X
 
 
19305
an inhibitor bound dengue NS3 protease
369
712
217
0
X
 
 
19304
kalata B7
154
0
0
0
X
 
 
19303
(HhH)2 domain of human FAAP24
333
196
56
0
X
 
 
19302
ERCC4 domain of human FAAP24
707
542
131
0
X
 
 
19301
CPR
181
523
181
0
X
 
 
19300
protoxin-1
190
81
32
0
X
 
 
19299
MLV CTD IN
396
334
74
0
X
 
 
19298
RBPMS2-Nter
182
256
85
0
X
 
 
19297
holo DC-SIGNR CRD
451
431
116
0
X
 
 
19296
Pin1 WW domain mutant 6-1g
231
0
0
0
X
 
 
19295
Pin1 WW domain variant 6-1
222
0
0
0
X
 
 
19294
DNA-binding domain of T. brucei telomeric protein tbTRF
97
0
98
0
X
 
 
19293
calcium-bound human S100A12
379
296
75
0
X
 
 
19292
Pin1 WW domain mutant 5-1g
221
0
0
0
X
 
 
19291
Pin1 WW domain mutant 5-1
212
0
0
0
X
 
 
19290
NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA
1155
864
182
11
X
 
X
19288
HR7784A
529
369
90
0
X
 
 
19287
NACI
300
184
58
0
X
 
 
19286
BeF3 Activated Sma0114
206
71
103
0
X
 
 
19285
Calcium Sensor
143
199
69
0
X
 
 
19283
RXFP2_LDLa
234
107
43
0
X
 
 
19282
lymphocyte receptor NKR-P1A
831
622
157
0
X
 
 
19281
d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid
260
0
0
0
 
X
 
19280
d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid
263
0
0
0
 
X
 
19279
d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid
245
0
0
0
 
X
 
19278
d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid
266
0
0
0
 
X
 
19277
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
240
0
0
0
 
X
 
19276
d[CGCGAAGCATTCGCG] hairpin
139
0
0
0
 
X
 
19275
Bovicin HJ50
179
106
0
0
X
 
 
19274
Dictyostelium discodieum Myosin Light Chain, MlcC
431
320
81
0
X
 
 
19273
holo-Ferredoxin
81
241
81
0
X
 
 
19272
YopH
271
760
271
0
X
 
 
19271
CRABP1 apo
130
401
130
0
X
 
 
19270
Sigma-1 receptor chaperone domain
212
297
105
0
X
 
 
19269
E7N
227
133
0
0
X
 
 
19268
HuPRP
800
425
160
0
X
 
 
19267
OEP16
271
443
150
0
X
 
 
19266
SNARE
0
0
0
0
X
 
 
19264
W184AM185A mutant of the HIV-1 capsid protein
206
648
206
0
X
 
 
19263
MPERp
197
7
0
0
X
 
 
19262
MPERp
190
18
0
0
X
 
 
19261
HIV capsid dimer
178
563
178
0
X
 
 
19260
RNA_(48-MER)
339
247
32
0
 
 
X
19259
Pin1
253
182
39
0
X
 
 
19258
Pin1 WW domain
248
182
37
0
X
 
 
19257
Alpha-synuclein
114
245
114
0
X
 
 
19256
FimH -heptyl-mannose complex
802
622
171
0
X
 
 
19255
FimH Y48A mutant
189
0
171
0
X
 
 
19254
FimH Y48A mutant - Heptyl-mannose complex
188
0
170
0
X
 
 
19253
tau_K18
115
370
115
0
X
 
 
19252
RRM domain of HUMAN RBM7
506
298
80
0
X
 
 
19251
Nlh2
349
187
58
0
X
 
 
19250
LASSO PEPTIDE ASTEXIN3
131
0
0
0
X
 
 
19249
PAI subdomain of Sleeping Beauty transposase
274
0
54
0
X
 
 
19248
SRSF1 RRM2 in complex with the RNA 5'-UGAAGGAC-3'
558
271
89
0
X
 
X
19247
plastocyanin
101
188
97
0
X
 
 
19245
HisJ and Histidine
228
697
228
0
X
 
 
19244
Domain 2 from E. coli HisJ
94
290
94
0
X
 
 
19243
Domain 1 from E. coli HisJ
139
425
139
0
X
 
 
19242
apo-HisJ
229
697
229
0
X
 
 
19241
FKBP12
626
479
105
0
X
 
 
19240
FKBP12
627
479
105
0
X
 
 
19239
2c TCR
188
543
188
0
X
 
 
19238
Calmodulin_prototypical_calcium_sensor
523
440
143
0
X
 
 
19237
AhPDF1 from Arabidopsis halleri
306
128
30
0
X
 
 
19236
plastocyanin
94
195
94
0
X
 
 
19235
Aha1 dimer from Colwellia psychrerythraea
774
603
136
0
X
 
 
19234
MSP1-E28K
538
287
104
0
X
 
 
19233
msp1
556
382
108
0
X
 
 
19232
two-domain RNA-binding fragment of Nrd1
217
71
127
0
X
 
 
19231
PmrA
609
460
110
0
X
 
 
19230
Hdm2
531
147
121
0
X
 
 
19229
PHD Domain from Human SHPRH
409
285
68
0
X
 
 
19228
Pdx1
61
184
61
0
X
 
 
19227
Pdx1
50
161
50
0
X
 
 
19226
2'F-RNA/2'F-ANA chimeric duplex
0
0
0
0
 
 
 
19225
GM_CBM21
818
422
144
0
X
 
 
19224
PTP1B
286
553
286
0
X
 
 
19223
PTP1B
232
512
232
0
X
 
 
19221
proteasome related subunit C terminal domain
998
785
187
0
X
 
 
19220
proteasome related subunit N terminal domain
879
670
170
0
X
 
 
19219
Yeast Rpn9
1818
1513
396
0
X
 
 
19218
Grx8
186
89
32
0
X
 
 
19217
SmTSP2EC2
494
274
82
0
X
 
 
19216
sod2 TM IV
143
0
35
0
X
 
 
19215
gp41-M-MAT
223
152
64
0
X
 
 
19214
Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain
676
547
145
0
X
 
 
19213
TePixJ
803
645
171
0
X
 
 
19212
rhodostomin 48ARGDWN-67NPWNG mutant
369
0
70
0
X
 
 
19211
rhodostomin 48ARGDWN-67NGLYG mutant
364
0
71
0
X
 
 
19210
rhodostomin P48A/M52W/P53N mutant
349
0
68
0
X
 
 
19209
HDHD4
210
654
210
0
X
 
 
19208
Arginine kinase transition state analogue complex
321
963
320
0
X
 
 
19207
HDHD4
201
610
201
0
X
 
 
19206
PcCBM36 monomer
679
544
131
0
X
 
 
19205
Engineered Cystine Knot Protein 2.5D
160
114
33
0
X
 
 
19204
BAF155 SWIRM domain
510
280
86
0
X
 
 
19203
RRM2 of Homo sapiens splicing factor, arginine/serine-rich 1
511
281
87
0
X
 
 
19202
CONANTOKIN BK-B
35
23
0
0
X
 
 
19201
TAX1BP1 UBZ1+2
424
295
72
0
X
 
 
19200
LDLa
211
111
42
0
X
 
 
19198
SP18156A
391
233
70
0
X
 
 
19197
C-terminal structure of (Y81F)-EhCaBP1
303
266
68
0
X
 
 
19196
(Y81F)-EhCaBP1
271
248
60
0
X
 
 
19195
alfa-actinin from parasite Entamoeba histolytica
743
537
136
0
X
 
 
19194
20S-11S proteasome-activator complex
109
247
109
0
X
 
 
19193
(Y81F)-EhCaBP1
273
248
60
0
X
 
 
19192
beta-Hairpin Peptidomimetic Antibiotics
103
28
0
0
X
 
 
19191
eIF4E
338
262
60
0
X
 
 
19190
LptD
99
29
0
0
X
 
 
19189
hL-FABP
264
364
125
0
X
 
 
19188
hL-FABP:OLA
251
373
126
0
X
 
 
19187
Methanothermobacter thermautotrophicus MCM C-terminus
539
405
83
0
X
 
 
19186
S72-S107 peptide of 18.5 kDa MBP
70
114
34
0
X
 
 
19185
PilA
304
221
58
0
X
 
 
19184
calmodulin-binding domain of plant calcium-ATPase ACA2
174
0
0
0
X
 
 
19183
Trp-cage 16b P12W: a Hyperstable Miniprotein
113
0
0
0
X
 
 
19182
Aprataxin
150
334
150
0
X
 
 
19181
PorH
295
0
66
0
X
 
 
19180
Trp-cage Circular Permutant
112
0
0
0
X
 
 
19179
mol1
395
307
75
0
X
 
 
19178
MS1
388
300
85
0
X
 
 
19177
[Asp2,11]RTD-1
101
51
0
0
X
 
 
19176
[Asp11]RTD-1
101
51
0
0
X
 
 
19175
[Asp2]RTD-1
102
52
0
0
X
 
 
19174
Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 1
47
91
47
0
X
 
 
19173
PTPN11 C-SH2 bound
675
504
120
0
X
 
 
19172
PTPN11 C-SH2 free
687
507
120
0
X
 
 
19171
TRD of MBD1
374
258
91
0
X
 
 
19170
calmodulin-binding domain of plant calcium-ATPase ACA8
174
0
0
0
X
 
 
19169
PG_2175
860
669
163
0
X
 
 
19168
C-terminal domain of translation initiation factor IF-3
589
433
95
0
X
 
 
19167
CsPABP1
516
447
108
0
X
 
 
19165
HdeA homodimer
405
358
91
0
X
 
 
19164
cerebral dopamine neurotrophic factor (CDNF)
968
709
149
0
X
 
 
19163
J-domain of human DnaJA1
372
277
63
0
X
 
 
19162
p7 channel of Hepatitis C virus, genotype 5a
111
224
58
0
X
 
 
19161
Amelogenin in SDS
100
369
100
0
X
 
 
19160
hL-FABP:GCA
424
360
128
0
X
 
 
19159
d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex
224
0
0
22
 
X
 
19158
DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')
181
0
0
18
 
X
 
19156
Hedgehog Autoprocessing Domain
745
581
134
0
X
 
 
19155
CbpAN from Streptococcus pneumoniae
510
356
87
0
X
 
 
19154
Sungsanpin
91
77
0
0
X
 
 
19153
IGF2R
815
597
151
0
X
 
 
19152
holo YqcA
805
627
158
0
X
 
 
19151
apo YqcA
760
587
138
0
X
 
 
19150
NpF2164-GAF3
356
509
179
0
X
 
 
19149
actinobacterial transcription factor RbpA
250
189
45
0
X
 
 
19148
actinobacterial transcription factor RbpA
239
189
44
0
X
 
 
19147
APC/C_CDH1-EMI1: multimodal mechanism of E3 ligase shutdown
527
355
86
0
X
 
 
19146
RING domain of E3 ubiquitin ligase Doa10
466
349
83
0
X
 
 
19143
FepB
268
860
268
0
X
 
 
19142
vertebrate toxin from the badge huntsman spider
147
64
19
0
X
 
 
19141
Dynorphin A, L5S
47
0
0
0
X
 
 
19140
R6W-DynA
55
0
0
0
X
 
 
19138
ED Complex
203
329
101
0
X
 
 
19137
ERGi
175
280
88
0
X
 
 
19136
ERGu
164
250
84
0
X
 
 
19135
MAP2c
2005
1847
465
0
X
 
 
19134
YbeA
135
422
135
0
X
 
 
19133
ttLO959M
35
0
0
0
X
 
 
19132
ctLO959W
40
0
0
0
X
 
 
19131
tIn936M
45
13
0
0
X
 
 
19130
cIn936M
44
13
0
0
X
 
 
19129
tIn936W
35
7
0
0
X
 
 
19128
cIn936
37
6
0
0
X
 
 
19126
GlyR
565
283
155
0
X
 
 
19125
BRPF1 momomer
99
317
99
0
X
 
 
19124
antimicrobial peptide Tk-Amp-X2
175
76
31
0
X
 
 
19123
B2705-b2m-pGR complex
92
0
92
0
X
 
 
19122
B2705-b2m-pLMP2 complex
80
0
80
0
X
 
 
19121
B2705-b2m-TIS complex
79
0
79
0
X
 
 
19120
B2705-b2m-pVIPR complex
79
0
79
0
X
 
 
19119
B2709-b2m-pGR complex
91
0
92
0
X
 
 
19118
B2709-b2m-pLMP2 complex
80
0
80
0
X
 
 
19117
Domain 11:IGF2 complex
792
558
150
0
X
 
 
19116
B2709-b2m-TIS complex
82
0
82
0
X
 
 
19114
4E-BP2
209
438
113
0
X
 
 
19113
B2709-b2m-pVIPR complex
93
262
93
0
X
 
 
19112
MS1
101
66
20
0
X
 
 
19111
USP25
787
603
162
0
X
 
 
19110
PI3-SH3
393
328
92
0
X
 
 
19109
EH domain of EHD3 in presence of Ca2+
639
462
101
0
X
 
 
19108
human restriction factor APOBEC3A
950
502
203
0
X
 
 
19107
Phl p 5a
1140
936
217
0
X
 
 
19106
TICAM-1
951
692
174
0
X
 
 
19105
NB22
74
223
74
0
X
 
 
19104
MS1
74
225
74
0
X
 
 
19103
ar1248
58
36
0
0
X
 
 
19102
M-2 Branch Mini-M Conotoxins
67
36
0
0
X
 
 
19101
Enterocin 7B
257
0
0
0
X
 
 
19099
human beta-2 microglobulin
292
308
76
0
X
 
 
19098
Nop6
788
581
136
0
X
 
 
19095
SsoSSB
693
505
133
0
X
 
 
19094
Enterocin 7A
266
0
0
0
X
 
 
19093
adenylate kinase with ADP
185
0
192
0
X
 
 
19092
adenylate kinase with ADP
192
0
191
0
X
 
 
19091
adenylate kinase with ADP
171
0
171
0
X
 
 
19090
adenylate kinase with ADP
135
0
135
0
X
 
 
19089
adenylate kinase with ADP
201
0
201
0
X
 
 
19088
Rv2140c
155
308
155
0
X
 
 
19087
C-terminal RV0431
356
351
88
0
X
 
 
19086
Solution structure of human ribosomal protein P1.P2 heterodimer
512
205
0
0
X
 
 
19085
SPI-2 inhibitor
205
96
42
0
X
 
 
19084
mengovirus
223
251
65
0
X
 
 
19083
SENP1
275
447
216
0
X
 
 
19082
thymidylate_synthase
322
774
230
0
X
 
 
19081
P4_CPEB3
179
0
0
0
 
 
X
19080
NS2B-NS3pro
597
568
195
0
X
 
 
19079
2A proteinase from a common cold agent, human rhinovirus RV-C02, strain W12
693
515
125
0
X
 
 
19078
fibrillin e2cb1
833
624
170
0
X
 
 
19077
USP28 monomer
614
487
111
0
X
 
 
19076
CcP
195
515
195
0
X
 
 
19075
CcP-PPIX
183
609
183
0
X
 
 
19074
DidoPHD/H3K4me3
333
266
66
0
X
 
 
19071
GLUCAGON AIB2,16 LYS13-GAMMAGLU-GAMMAGLU-C16 AMIDE
172
0
0
0
X
 
 
19070
GLUCAGON AIB2,16 LYS13-GAMMAGLU-GAMMAGLU-C16 AMIDE
195
0
0
0
X
 
 
19069
EFGP
1407
1036
245
0
X
 
 
19068
HR2876C
507
373
91
0
X
 
 
19067
Solution structure of latherin
1181
917
205
0
X
 
 
19066
Solution structure of the FimH adhesin carbohydrate-binding domain
872
694
171
0
X
 
 
19065
RNaseA
116
0
116
0
X
 
 
19064
TIAR RRM2
83
246
83
0
X
 
X
19063
TIAR RRM2
83
252
83
0
X
 
 
19061
S100A15
386
305
76
0
X
 
 
19059
ns5a308
131
81
14
0
X
 
 
19057
peptide
109
0
0
0
X
 
 
19056
IsdB N1
620
419
132
0
X
 
 
19054
human apoptotic protein tBid
737
564
125
0
X
 
 
19053
FimA wt
454
0
0
0
X
 
 
19052
Ebolavirus_Fusion_Loop_L529A/I544A
292
209
49
0
X
 
 
19051
calcium_channel_beta_subunit
290
900
292
0
X
 
 
19050
Calmodulin IQ motif complex
502
314
78
0
X
 
 
19049
Solution structure of chicken Engrailed 2 homeodomain
410
332
85
0
X
 
 
19048
BcII
1280
730
231
0
X
 
 
19047
BcII
1287
710
235
0
X
 
 
19046
Phosphatase domain of PTPN5
212
460
212
0
X
 
 
19045
BID-BAK complex
1131
556
176
0
X
 
 
19044
PMM/PGM_D4
517
409
90
0
X
 
 
19043
Protein A binding by an engineered Affibody molecule
717
507
135
0
X
 
 
19042
Frataxin like monomer
700
365
121
0
X
 
 
19041
VEGFR2tm
232
169
42
0
X
 
 
19040
2'-5' AG1 lariat forming ribozyme
430
347
12
0
 
 
X
19039
domain 5 from Azotobacter vinelandii Intron 5
222
146
31
0
 
 
X
19038
complex of cytochrome P450cam and its electron donor putidaredoxin
247
0
247
0
X
 
 
19037
h-prune C-terminal domain
199
247
86
0
X
 
 
19036
Calmodulin/a-syn peptide complex
341
308
157
0
X
 
 
19035
G-rich VEGF aptamer with LNA modifications
189
0
0
0
 
X
 
19034
third RNA Recognition Motif (RRM) of U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
607
367
102
0
X
 
 
19033
SH3 domain of human RAS GAP 1
368
214
69
0
X
 
 
19032
Huwentoxin-IV
161
0
0
0
X
 
 
19030
Huwentoxin-IV
167
0
0
0
X
 
 
19029
K2A1
212
219
54
0
X
 
 
19028
MBF1-C
77
238
77
0
X
 
 
19027
rubredoxin type protein from Mycobacterium ulcerans
262
206
51
0
X
 
 
19026
HWTX-IV
177
0
0
0
X
 
 
19024
single G-bulge in a conserved regulatory region of the HEV genome
120
137
0
0
 
 
X
19023
RNA polymerase binding protein A (RbpA)
415
252
76
0
X
 
 
19018
E. coli ribosomela decoding site with apramycin
262
256
101
27
 
 
X
19017
Bulges in G-quadruplexes
183
0
0
0
 
X
 
19015
Galphai3 bound to GDP
301
925
301
0
X
 
 
19014
putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegans
639
478
108
0
X
 
 
19013
RRM domain of the hypothetical protein
694
532
131
0
X
 
 
19012
hypothetical protein BT_0846
579
329
103
0
X
 
 
19011
C1CT
111
331
111
0
X
 
 
19010
Titin_C1
154
475
154
0
X
 
 
19008
SinR_FL
496
489
115
0
X
 
 
19007
MinC N-terminal monomer
480
396
105
0
X
 
 
19006
VanU
571
461
111
0
X
 
 
19005
(His)6CcPCN
261
789
261
0
X
 
 
19004
CcP(His)6CN
267
820
267
0
X
 
 
19003
Core Domain (10-76) of the Feline Calicivirus VPg protein
405
307
81
0
X
 
 
19002
Core Domain (11-85) of the Murine Norovirus VPg protein
455
330
75
0
X
 
 
19001
OspE
868
653
163
0
X
 
 
19000
VV2_0175
499
356
71
0
X
 
 
18999
.
152
0
0
0
X
 
 
18998
Allatide O4 conformation 2
152
0
0
0
X
 
 
18995
Human S100B and Basic Fibroblast Growth Factor (FGF2) Interaction
81
250
81
0
X
 
 
18994
zNTD
768
538
138
0
X
 
 
18993
Alt_a_1
126
379
126
0
X
 
 
18992
[2Fe-2S]Fdx
79
174
79
0
X
 
 
18991
[2Fe-2S]Fdx
93
261
89
0
X
 
 
18990
protein
660
540
134
0
X
 
 
18989
CgR160
871
643
156
0
X
 
 
18988
apo_paHO
152
478
149
0
X
 
 
18987
SACOL0876
676
487
109
0
X
 
 
18986
C-terminus of the minichromosome maintenance protein MCM
531
391
82
0
X
 
 
18985
DNA_1
182
0
0
20
 
X
 
18984
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
182
0
0
20
 
X
 
18982
CIC_polypeptid
758
390
124
0
X
 
 
18981
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
185
0
0
21
 
X
 
18980
NC inhibitor 3 complex
367
154
61
0
X
 
 
18979
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
179
0
0
20
 
X
 
18978
Ph1500: a homohexameric protein centered on a 12-bladed beta-propeller
883
674
131
0
X
 
 
18977
Phosphate-bound TpbA
491
298
166
0
X
 
 
18976
Ca-containing EF-hand protein
879
663
159
0
X
 
 
18975
Unmodified Helix 69
160
128
0
0
 
 
X
18974
HELIX_69
155
46
0
0
 
 
X
18973
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
179
0
0
20
 
X
 
18972
SOLUTION STRUCTURE OF THE SOMATOSTATIN SST3 RECEPTOR ANTAGONIST TAU-CONOTOXIN CnVA
87
51
0
0
X
 
 
18971
WW3*-aENaC PY peptide complex
315
219
60
0
X
 
 
18970
peptide
94
44
0
0
X
 
 
18969
S55A mutant of UVI31+
94
288
94
0
X
 
 
18968
Denatured SOD1
146
299
148
0
X
 
 
18967
E6
465
337
80
0
X
 
 
18966
ComP
605
466
93
0
X
 
 
18965
Marine Sponge-Derived Asteropsin E
186
109
0
0
X
 
 
18964
Novel Alpha4/6-Conotoxin TxIC
69
0
0
0
X
 
 
18963
Dido_PHD
358
268
68
0
X
 
 
18961
HP0242
527
419
91
0
X
 
 
18959
Rsa1p238-259
160
90
26
0
X
 
 
18958
Integrin L Transmembrane Domain
324
170
54
0
X
 
 
18956
STRUCTURE OF NAB2P TANDEM ZINC FINGER 34
418
301
72
0
X
 
 
18955
STRUCTURE OF NAB2P TANDEM ZINC FINGER 12
444
313
74
0
X
 
 
18954
GUCT
546
307
101
0
X
 
 
18953
gammaM-crystallin
689
648
165
0
X
 
 
18952
Phospholamban
49
0
49
0
X
 
 
18951
MYB-like DNA binding domain of KNL-2 from C. Elegans
289
170
47
0
X
 
 
18950
3',5'-LINKED 2'-O-(2-METHOXYETHYL)-RNA DUPLEX
173
0
0
0
 
 
X
18949
GroES
45
0
43
0
X
 
 
18948
LASSO PEPTIDE ASTEXIN-1(19)
110
0
0
0
X
 
 
18947
SpnDE1
326
237
65
0
X
 
 
18946
As1a
191
136
40
0
X
 
 
18945
k-Ssm1a
311
209
63
0
X
 
 
18944
Gbx1
430
245
74
0
X
 
 
18943
N-terminal domain of pneumococcal PhtD protein with bound Zn(II)
692
529
128
0
X
 
 
18942
alpha-1 integrin I-domain in complex with GLOGEN triple helical peptide
968
740
189
0
X
 
 
18941
LFA-1 I-Domain
305
447
175
0
X
 
 
18940
S2
67
0
0
0
X
 
 
18939
C-terminal AbrB
225
168
43
0
X
 
 
18938
BTD-2[3,4]
103
53
0
0
X
 
 
18937
[Aba3,5,7,12,14,16]BTD-2
122
54
0
0
X
 
 
18935
African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA
300
571
165
0
X
X
 
18934
Binary complex of African Swine Fever Virus Pol X with MgdGTP
1135
796
180
0
X
 
 
18933
ASFV Pol X
154
430
154
0
X
 
 
18931
[Aba5,7,12,14]BTD-2
116
53
0
0
X
 
 
18930
T638E/S657E V5 domain of Protein Kinase C alpha, DPV
52
162
52
0
X
 
 
18929
V5 domain of Protein Kinase C alpha
55
176
55
0
X
 
 
18928
T638E/S657E V5 domain of Protein Kinase C alpha
57
188
57
0
X
 
 
18927
V5 domain of Protein Kinase C alpha
57
188
57
0
X
 
 
18926
MCh-1
144
0
0
0
X
 
 
18925
chain_A
255
0
0
0
X
 
 
18924
chain_A
297
0
0
0
X
 
 
18923
[L-HisB24] insulin analogue at pH 8.0
255
0
0
0
X
 
 
18922
PmrAn dimer
408
352
117
0
X
 
 
18921
[L-HisB24] insulin analogue at pH 1.9
292
0
0
0
X
 
 
18920
Entamoeba histolytica HP1 chromodomain
290
234
65
0
X
 
 
18919
Full-length cytochrome b5 with heme B
589
157
101
0
X
 
 
18918
NTL9_V3AI4A
54
160
54
0
X
 
 
18917
tstm1395
346
262
67
0
X
 
 
18916
BRCT domain of yeast REV1
546
398
86
0
X
 
 
18914
[Aba3,7,12,16]BTD-2
116
52
0
0
X
 
 
18913
[Aba3,16]BTD-2
110
54
0
0
X
 
 
18912
ADAM17
302
8
63
0
X
 
 
18911
NMR structure of the catalytic domain from E. faecium L,D-transpeptidase acylated by ertapenem
743
555
130
0
X
 
 
18910
NMR solution structure of the AVR3a11 from Phytophthora Capsici
325
205
58
0
X
 
 
18909
hs00507
465
332
74
0
X
 
 
18908
Human programmed cell death 1 receptor
660
453
119
0
X
 
 
18907
Duplex DNA
225
0
0
0
 
X
 
18906
CHD4
476
306
74
0
X
 
 
18905
RRM2 domain of the protein RBM10 from homo sapiens
606
446
124
0
X
 
 
18904
two domain PPIase SlpA from Escherichia coli
842
466
151
0
X
 
 
18902
major G-quadruplex
202
0
0
0
 
X
 
18901
C-terminal domain of the protein HCFC1
616
464
111
0
X
 
 
18900
NMR structure of the catalytic domain from E. faecium L,D-transpeptidase
756
577
136
0
X
 
 
18899
Doc monomer
608
488
116
0
X
 
 
18898
LMO4-DEAF-1 tethered complex
522
354
103
0
X
 
 
18897
NMR structure of the glycosylated conotoxin CcTx from Conus consors
199
126
0
0
X
 
 
18896
BI-FUNCTIONAL LYSOZYME-PROTEASE INHIBITOR
251
199
57
0
X
 
 
18895
N-terminal MAP1B LC
647
489
124
0
X
 
 
18894
d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma
223
102
18
0
 
 
X
18893
d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1
306
78
13
0
 
 
X
18892
helix II template boundary element from Tetrahymena telomerase RNA
184
151
34
0
 
 
X
18891
Tetrahymena telomerase RNA stem IV terminal loop
181
141
19
0
 
 
X
18890
CD3g cytosolic domain
43
136
43
0
X
 
 
18889
CD3e
47
152
47
0
X
 
 
18888
EGFR transmembrane - juxtamembrane (TM-JM) segment
226
223
55
0
X
 
 
18887
hypothetical protein lmo0427
610
462
112
0
X
 
 
18885
Rpt6
112
299
112
0
X
 
 
18884
CD79b
48
145
48
0
X
 
 
18883
TICAM-1 TIR domain
1013
750
186
0
X
 
 
18882
TICAM-2 TIR domain
1003
696
169
0
X
 
 
18881
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
288
56
41
0
 
X
X
18880
MlcB
441
322
85
0
X
 
 
18879
SP-B C-terminal (residues 59-80) peptide
131
0
24
0
X
 
 
18878
Solution structure of the Hs. PSIP1 PWWP domain
591
408
90
0
X
 
 
18877
CaBP4 polypeptide
621
542
159
0
X
 
 
18876
Complex of MDM2(3-109) and p73 TAD(10-25)
616
384
111
0
X
 
 
18875
[Aba5,14]BTD-2, cyclic peptide
106
54
0
0
X
 
 
18874
ING4 PHD mutant N214D
330
0
61
0
X
 
 
18873
Lewisx-sp8 acetate
31
22
0
0
 
 
 
18872
ID3 stem
73
59
0
0
 
 
X
18871
chaperone in type III secretion system
60
203
60
0
X
 
 
18870
dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)
511
399
104
0
X
 
 
18869
HR8910C
361
283
65
0
X
 
 
18868
Human S100A6 (C3S) with V domain of Receptor for Advanced Glycation End products (RAGE)
84
195
84
0
X
 
 
18867
CD79a
120
351
120
0
X
 
 
18865
OvDpl(1-30)
184
0
0
0
X
 
 
18864
CsPinA
574
332
90
0
X
 
 
18863
MS1
328
278
78
0
X
 
 
18862
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
111
0
0
0
 
X
 
18861
Antiamoebin I
109
64
14
0
X
 
 
18859
Biosynthetic engineered B28K-B29P human insulin monomer
267
0
0
0
X
 
 
18858
Biosynthetic engineered B28K-B29P human insulin monomer
287
0
0
0
X
 
 
18857
alpha-synuclein
279
270
134
0
X
 
 
18856
GtYybT PAS Homodimer
721
498
122
0
X
 
 
18855
YibK
146
444
146
0
X
 
 
18854
Human S100A6 C3S
83
194
83
0
X
 
 
18853
LpoA_n-ter
1348
1036
265
0
X
 
 
18852
HIV-1 Rev ARM peptide (residues T34-R50)
156
100
28
0
X
 
 
18851
HIV-1 Rev ARM single polypeptide chain
149
103
27
0
X
 
 
18850
Haloferax volcanii HVO_2177 protein
554
441
98
0
X
 
 
18849
BfmrC
564
420
96
0
X
 
 
18848
LTBP1-E3cb15
363
291
95
0
X
 
 
18847
stacked G-quadruplex formed by human TERRA sequence
232
0
0
0
 
 
X
18846
SUP-12
570
430
99
0
X
 
X
18845
SUP-12
570
431
99
0
X
 
 
18844
UBLCP1
463
258
77
0
X
 
 
18843
FUN-EGF3
705
512
136
0
X
 
 
18842
complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4
724
552
144
0
X
 
 
18841
Antitoxin PaaA2
430
311
70
0
X
 
 
18840
CPEB1-ZZ_G-P-504-566
394
283
76
0
X
 
 
18839
monomeric sugarcane canecystatin
590
419
116
0
X
 
 
18838
ID3 stem loop of domain 1 in the ai5gamma group II intron
158
132
0
0
 
 
X
18837
VHH 18
617
422
124
0
X
 
 
18835
dodecamer duplex
109
0
0
0
 
X
 
18834
PDZ
502
391
87
0
X
 
 
18833
PDZ
513
394
90
0
X
 
 
18832
SH3 domain of DOCK180
419
212
61
0
X
 
 
18831
U14Ub1
428
328
70
0
X
 
 
18830
ALPS-23 peptide in SDS micelles
121
0
0
0
X
 
 
18829
TIA-1 protein
97
199
97
0
X
 
 
18828
holocytochrome c
122
0
112
0
X
 
 
18826
C-terminal CFTR peptide and extended PDZ2 domain from NHERF1
770
508
132
0
X
 
 
18825
C-terminal CFTR peptide and extended PDZ1 domain from NHERF1
682
481
116
0
X
 
 
18824
extended PDZ1 domain from NHERF1
679
479
119
0
X
 
 
18823
PpdD
635
460
124
0
X
 
 
18822
trans-membrane domain of the NS2A
133
26
26
0
X
 
 
18821
ApoAcpP
441
337
82
0
X
 
 
18820
ApoAcpP-1
373
186
73
0
X
 
 
18819
ApoAcpP-3
449
349
81
0
X
 
 
18818
human S100A14
458
417
102
0
X
 
 
18817
KCNE2
127
340
104
0
X
 
 
18816
CR10
215
164
44
0
X
 
 
18815
his-eiav-ca
207
650
207
0
X
 
 
18813
human PHF1 in complex with H3K36me3
360
239
61
0
X
 
 
18812
DUF3349
471
376
96
0
X
 
 
18811
Spidroin
514
313
112
0
X
 
 
18809
SP-B C-terminal residues 59-80
133
0
0
0
X
 
 
18808
Nterminal domain of splicing factor 1
384
468
209
0
X
 
 
18806
Miz58
579
429
98
0
X
 
 
18805
HR4490C
367
259
60
0
X
 
 
18804
ErbB1 (EGFR, HER1)
272
202
46
0
X
 
 
18803
MHV N-linker peptide
27
60
27
0
X
 
 
18802
SF1N
739
553
116
0
X
 
 
18801
NmPin
554
384
94
0
X
 
 
18800
HO-1
214
666
214
0
X
 
 
18799
HO-1
189
597
189
0
X
 
 
18798
HO-1
218
672
218
0
X
 
 
18797
OmpX in DPC micelles
128
383
128
0
X
 
 
18796
OmpX in phopspholipid nanodiscs
131
377
131
0
X
 
 
18795
Amylin monomer
112
0
35
0
X
 
 
18794
module 2 from the E1 domain of C. elegans APL-1
391
252
68
0
X
 
 
18793
BCL-xL in complex with PUMA BH3 peptide
355
541
173
0
X
 
 
18792
BCL-xL
227
536
171
0
X
 
 
18791
WzcCD
229
702
229
0
X
 
 
18789
Kunitz-type neurotoxin LmKKT-1a
306
158
58
0
X
 
 
18788
staphylococcal nuclease E43S mutant
784
567
138
0
X
 
 
18787
F15L_polypeptide
436
0
73
0
X
 
 
18786
Erbin PDZ S47
108
215
108
0
X
 
 
18785
Erbin PDZ WT
106
213
106
0
X
 
 
18784
ABU8-3
196
114
0
0
X
 
 
18783
ASTEROPSIN B FROM MARINE SPONGE ASTEROPUS
199
118
0
0
X
 
 
18782
Solution structure of the QUA1 dimerization domain of pXqua, the Xenopus ortholog of Quaking.
344
246
52
0
X
 
 
18781
DNA
88
0
0
0
 
X
 
18780
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
89
0
0
0
 
X
 
18779
FrpD_protein
217
687
217
0
X
 
 
18778
LIMD2
317
161
64
0
X
 
 
18777
MS1
418
616
201
0
X
 
 
18776
Hordeum vulgare glycine rich- RNA binding protein 1
394
248
91
0
X
 
 
18775
omp synthase
213
657
213
0
X
 
 
18774
omp synthase
212
656
212
0
X
 
 
18773
SCIN-B
82
242
82
0
X
 
 
18772
SCIN-A
78
240
78
0
X
 
 
18771
TatA oligomer
76
31
45
0
X
 
 
18770
TatA T22P
267
144
48
0
X
 
 
18769
NS2(32-57) GBVB protein
181
108
0
0
X
 
 
18768
NS2(2-32) GBVB protein
176
102
0
0
X
 
 
18766
PI-AnmTX Ugr 9a-1
153
77
0
0
X
 
 
18765
RRM1 monomer
554
415
99
0
X
 
 
18764
Phf19 links methylated lysine 36 of histone H3 to regulation of Polycomb activity
360
198
59
0
X
 
 
18763
FGFR3tm
248
189
47
0
X
 
 
18762
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
154
0
0
0
 
X
 
18761
FE65 PTB2
604
513
131
0
X
 
 
18760
YLTA IkappaBalpha
188
201
188
0
X
 
 
18759
CPAP IkappaBalpha
141
113
141
0
X
 
 
18758
First Catalytic Cysteine Half-domain
641
469
110
0
X
 
 
18757
theta-defensin HTD-2 (retrocyclin 2)
101
49
10
0
X
 
 
18756
WT IkappaBalpha
139
163
139
0
X
 
 
18755
Mdm2 (6-125) with Pip-1
489
405
113
0
X
 
 
18754
apo-IscU
25
16
3
0
X
 
 
18753
biofilm matrix promoter AbbA from B. subtilis
361
274
68
0
X
 
 
18750
IscU
25
16
2
0
X
 
 
18749
Ligase 10C
276
227
61
0
X
 
 
18748
Grb2 C-terminal SH3 domain
50
158
50
0
X
 
 
18741
Fibroblast Growth Factor Recoptor
254
814
254
0
X
 
 
18740
KSR1 CC-SAM
136
280
136
0
X
 
 
18738
eIF4GI-HEAT1
210
591
210
0
X
 
 
18737
complex of ubiquitin and CD2-associated protein
133
0
133
0
X
 
 
18736
Conotoxin_TxIB
88
0
0
0
X
 
 
18735
HR3520O
501
358
86
0
X
 
 
18734
ZP_02034617.1
561
315
100
0
X
 
 
18733
NB7890A
593
336
115
0
X
 
 
18732
NP_390345.1
525
323
90
0
X
 
 
18730
West_nile_protease
189
557
187
0
X
 
 
18729
MS2
177
126
32
0
X
 
 
18728
UP1
1083
801
198
0
X
 
 
18726
AcSp1-RP
832
487
165
0
X
 
 
18725
Faap24
558
341
79
0
X
 
 
18724
G-quadruplex_DNA
183
0
0
0
 
X
 
18723
RTD-1
87
41
12
0
X
 
 
18722
BTD-2
98
54
16
0
X
 
 
18721
D5
186
557
186
0
X
 
 
18720
Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptide
18
524
123
0
X
 
 
18719
beta 2 integrin tail
44
0
44
0
X
 
 
18718
alpha 4 integrin tail
36
0
36
0
X
 
 
18717
Ska1-MTBD
634
536
118
0
X
 
 
18716
HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serine
749
434
131
0
X
 
 
18715
MA
742
434
131
0
X
 
 
18714
HR7907F
471
332
83
0
X
 
 
18713
sC4
683
487
116
0
X
 
 
18712
b-flap domain of RNA polymerase (B. subtilis)
738
409
138
0
X
 
 
18711
CH3CS
527
311
95
0
X
 
 
18710
recombinant brazzein
300
223
59
0
X
 
 
18709
HMG-box/p53
1046
749
159
0
X
 
 
18708
Structure of Co-substituted microcrystalline SOD using PCS and PRE restraints by solid-state NMR
136
245
136
0
X
 
 
18707
TamA POTRA domain I
489
283
77
0
X
 
 
18706
influenza A virus S31N mutant (19-49) in presence of drug M2WJ332
177
114
30
0
X
 
 
18705
Antimicrobial Peptide Human Defensin 5
151
96
27
0
X
 
 
18704
Siglec5 CRD
110
330
110
0
X
 
 
18703
2-mercaptophenol-alpha3C
430
293
64
0
X
 
 
18702
RNA BINDING PROTEIN Solution structure of the third KH domain of KSRP in complex with the G-rich target sequence.
431
235
0
0
X
 
X
18701
UNC-60B from Caenorhabditis elegans
835
646
144
0
X
 
 
18700
XIAP(RING)-binding domain of XAF1
334
237
57
0
X
 
 
18699
DIMERIC PIL-E G-QUADRUPLEX DNA
134
0
0
0
 
X
 
18698
HR8614A
629
466
113
0
X
 
 
18697
rmodN-ACSL complex
556
522
145
0
X
 
 
18696
rmodN
560
574
143
0
X
 
 
18695
KIX domain complex (3)
468
323
92
0
X
 
 
18694
KIX domain complex
555
437
108
0
X
 
 
18693
Exocrine gland-secreting peptide 4
551
410
100
0
X
 
 
18692
HP1264
437
301
71
0
X
 
 
18691
tpr1 domain
111
198
111
0
X
 
 
18690
MOMERIC PIL-E G-QUADRUPLEX DNA
188
0
0
0
 
X
 
18689
tpr2a
132
252
132
0
X
 
 
18688
gp78 RING bound to Ube2g2:G2BR
55
0
55
0
X
 
 
18687
E coli adenylate kinase
155
0
155
0
X
 
 
18686
E coli adenylate kinase: E170A
189
0
189
0
X
 
 
18684
Chimeric Peptide of HBD2 and HBD3
134
0
0
0
X
 
 
18683
E coli adenylate kinase: wild type
197
0
197
0
X
 
 
18682
LIP5-CHMP5
1147
651
228
0
X
 
 
18681
LIP5(MIT)2
956
522
185
0
X
 
 
18680
LmCsp
341
239
72
0
X
 
 
18679
LmCsp_dT7
335
232
73
0
X
 
 
18678
RRM1-RBM10
537
368
100
0
X
 
 
18677
RING domain in ubiquitin ligase gp78
298
232
70
0
X
 
 
18676
MMP23_pro-domain_polypeptide
144
161
67
0
X
 
 
18673
potential acylphosphatase from Giardia lamblia
494
409
99
0
X
 
 
18672
S4WYILD
578
418
105
0
X
 
 
18671
complex between the Sgt2 homodimerization domain and the Get5 UBL domain
766
522
136
0
X
 
 
18670
Sgt2 homodimerization domain
352
284
70
0
X
 
 
18669
Get5
438
270
78
0
X
 
 
18668
FeoA
69
223
69
0
X
 
 
18667
Solution structure of eIF4E3 in complex with m7GDP
1077
831
203
0
X
 
 
18666
dUTPase homotrimer
119
345
119
0
X
 
 
18665
dUTPase homotrimer
120
347
120
0
X
 
 
18664
NSD3
481
331
91
0
X
 
 
18663
The third member of the eIF4E family represses gene expression via a novel mode of recognition of the methyl-7 guanosine cap mo
1083
620
207
0
X
 
 
18662
SH3_domain_of_GAS7
357
266
64
0
X
 
 
18661
CSGI
103
0
0
0
X
 
 
18659
peptide epsilon(103-120)
90
0
0
0
X
 
 
18658
peptide a2N(1-17) from Mus musculus V-ATPase
80
0
0
0
X
 
 
18657
nfeAFP11
395
292
67
0
X
 
 
18656
Internal Loop 5'GAGU/3'UGAG
0
0
0
0
 
 
 
18655
Transmembrane Arced Helix (ArcH)
223
0
8
0
X
 
 
18654
Single-chain Insulin
314
191
54
0
X
 
 
18653
Bacterial Intein-Like domain from Clostridium thermocellum
787
607
139
0
X
 
 
18652
alpha sub-domain
205
214
101
0
X
 
 
18650
RelA-TAD/CBP-TAZ1 complex
940
531
175
0
X
 
 
18649
APPTM dimer
178
144
30
0
X
 
 
18648
APPTM V44M dimer
180
144
30
0
X
 
 
18647
mStARD4L124D
506
619
200
0
X
 
 
18645
PawS Derived Peptide 7 (PDP-7)
80
41
0
0
X
 
 
18644
PawS Derived Peptide 5 (PDP-5)
118
45
0
0
X
 
 
18643
PawS Derived Peptide 4 (PDP-4)
58
21
0
0
X
 
 
18642
Protein
344
256
62
0
X
 
 
18641
PawS derived peptide 11 (PDP-11)
106
46
0
0
X
 
 
18640
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
18639
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
18638
11_mer_oligonucleotide-B
142
0
0
0
 
X
 
18637
rNa-FAR-1
960
708
156
0
X
 
 
18636
MS1
707
544
139
0
X
 
 
18634
human -defensins 1 and 6
246
183
47
0
X
 
 
18633
small molecule-influenza RNA complex
186
0
0
0
 
 
X
18632
MS1
903
663
150
0
X
 
 
18631
N-80 ALR reduced
79
231
77
0
X
 
 
18630
N-80 ALR
72
225
81
0
X
 
 
18629
H-RasT35S mutant protein in complex with Kobe2601
88
77
0
0
X
 
 
18628
MS1
782
586
145
0
X
 
 
18627
VILIP-3 monomer
940
599
174
0
X
 
 
18626
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
198
0
0
0
 
X
 
18625
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
200
0
0
0
 
X
 
18624
N-terminal domain of a plant Grx
625
483
111
0
X
 
 
18623
mutant (T170E) second CARD of human RIG-I
559
431
96
0
X
 
 
18622
second CARD of human RIG-I
555
448
96
0
X
 
 
18621
La-type RNA-binding domain
468
361
80
0
X
 
 
18620
RRM domain
466
349
88
0
X
 
 
18619
Menk in DMPC SUV
28
0
0
0
X
 
 
18618
BAD-1 repeat loop
134
76
24
0
X
 
 
18617
G8A mutant of the influenza hemagglutinin fusion peptide
51
23
21
0
X
 
 
18615
Par17
687
662
153
0
X
 
 
18614
Myo10 anti-CC
283
155
51
0
X
 
 
18613
Eph receptor
784
449
163
0
X
 
 
18612
HisRS
872
503
147
0
X
 
 
18611
Ubiquitin
72
216
72
0
X
 
 
18610
Ubiquitin
115
287
115
0
X
 
 
18609
GGBP - Glucose
257
495
257
0
X
 
 
18608
ASC PYD
88
266
89
0
X
 
 
18607
Avrpiz-t
419
302
85
0
X
 
 
18606
anti-CRISPR protein Acr30-35
437
239
75
0
X
 
 
18605
HR8682B
606
447
107
0
X
 
 
18604
Solution structure of CCP modules 10-11 of complement factor H
758
568
123
0
X
 
 
18602
soluble domain of MmpS4
363
296
74
0
X
 
 
18601
GGBP_unbound
281
542
281
0
X
 
 
18600
S67
219
166
36
0
X
 
 
18599
FH11-12
717
550
125
0
X
 
 
18598
LytTR domain
100
302
100
0
X
 
 
18596
Eosinophil Cationic Protein
795
410
149
0
X
 
 
18593
RNA Duplex Containing a 2'-O-Pivaloyloxymethyl Modification
178
0
0
0
 
 
X
18592
MRH domain
523
361
96
0
X
 
 
18591
ilvN
531
387
98
0
X
 
 
18590
S. aureus pepA1 NMR structure
94
0
0
0
X
 
 
18589
Cbp2
477
395
89
0
X
 
 
18588
Tyr_tRNA_Synthase
299
900
299
0
X
 
 
18587
MHV nsp3a momoner
599
407
107
0
X
 
 
18586
MS1
414
316
77
0
X
 
 
18585
Griffithsin (GRFT)
107
244
107
0
X
 
 
18584
gp78CUE/K48-Ub2 complex
111
0
111
0
X
 
 
18583
gp78CUE/K48-Ub2 complex
111
0
111
0
X
 
 
18582
gp78CUE bound to ubiquitin
371
228
121
0
X
 
 
18581
gp78 CUE domain
306
231
53
0
X
 
 
18580
H6-vMycCterm
545
418
120
0
X
 
 
18579
Methylated Histone Complex
829
598
137
0
X
 
 
18578
Connexin45 Carboxyl Terminal Domain
625
505
123
0
X
 
 
18577
Connexin45 Carboxyl Terminal Domain
559
406
92
0
X
 
 
18576
Griffithsin (GRFT)
107
244
107
0
X
 
 
18575
variant XI LipA
1010
741
195
0
X
 
 
18574
wild-type Lipase A
1032
753
195
0
X
 
 
18573
Ca-bound Phl p 7
426
298
79
0
X
 
 
18572
hemi-Mg-bound Phl p 7
430
299
79
0
X
 
 
18571
apo-Phl p 7
424
296
79
0
X
 
 
18570
zinc finger AFV1p06 protein
356
271
59
0
X
 
 
18569
EVH1
669
371
137
0
X
 
 
18568
NS4B
237
132
0
0
X
 
 
18567
S114A mutant of UVI31+
107
314
107
0
X
 
 
18566
TL-domain
638
511
119
0
X
 
 
18565
MLD PMT
470
366
81
0
X
 
 
18563
HR8578K
508
393
92
0
X
 
 
18562
VvMARTX
339
323
73
0
X
 
 
18561
OR250
626
455
109
0
X
 
 
18560
hs356_22_132
592
424
113
0
X
 
 
18559
MLL5
410
298
74
0
X
 
 
18557
Ca2+-bound CaBP7 N-terminal doman
494
377
88
0
X
 
 
18556
complex between Ca-Calmodulin and skeletal muscle myosin light chain kinase
144
0
144
0
X
 
 
18555
PA1075
538
429
105
0
X
 
 
18553
ZirS C-terminal Domain
753
540
125
0
X
 
 
18552
TM4-Cx43CT monomer
630
413
132
0
X
 
 
18551
C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497)
410
307
79
0
X
 
 
18550
V210I
791
460
132
0
X
 
 
18549
Helix-35 Stem-loop from E. coli 23S rRNA
185
181
42
0
 
 
X
18548
Fam96a
830
595
136
0
X
 
 
18547
MiR12
1064
783
201
0
X
 
 
18546
tandem zinc finger domain of Stc1
565
385
105
0
X
 
 
18545
C85M_S100A1 dimer
516
385
94
0
X
 
 
18542
Cytosolic Tails of aXb2 Integrin
153
28
0
0
X
 
 
18541
midkine-b
501
331
115
0
X
 
 
18540
midkine-a
554
367
122
0
X
 
 
18539
protein_16
730
433
133
0
X
 
 
18538
GPVI peptide mimetic
119
57
0
0
X
 
 
18537
collagelin
83
41
0
0
X
 
 
18536
KB1[GHRW; 23-28]
138
0
0
0
X
 
 
18535
Ribonuclease III
433
355
84
0
X
 
 
18534
Ribonuclease III in complex with RNA (32-MER)
672
487
90
0
X
 
X
18533
mptpa
868
516
159
0
X
 
 
18532
RNA Aptamer for B. anthracis Ribosomal Protein S8
220
201
65
0
 
 
X
18531
GB3
322
185
54
0
X
 
 
18530
C7CCPs
752
569
132
0
X
 
 
18529
K-Ras-GDP
455
489
161
0
X
 
 
18528
alpha tubulin 404-451
261
0
0
0
X
 
 
18527
beta tubulin 394-445
306
0
0
0
X
 
 
18526
HR3504C
981
700
152
0
X
 
 
18524
DNA_OUH
325
130
0
0
 
X
 
18523
HSP12 SDS
609
425
111
0
X
 
 
18522
PICK1 PDZ domain fused to the C10 DAT ligand
504
382
106
0
X
 
 
18521
Vta1-Vps60 complex
1315
926
232
0
X
 
 
18520
S72-S107 peptide of 18.5kDa murine MBP
163
141
36
0
X
 
 
18519
Retro Trp-cage peptide
124
65
0
0
X
 
 
18518
LC3B OPTN-LIR Ptot complex structure
874
548
141
0
X
 
 
18517
EDK-delta-Bd37
1196
693
208
0
X
 
 
18516
PSD95
109
284
101
0
X
 
 
18515
RNA (37-MER)
277
0
0
0
 
 
X
18514
MSL2
291
207
50
0
X
 
 
18513
recombinant tamapin
181
0
0
0
X
 
 
18511
HR8578D
452
332
79
0
X
 
 
18510
m-conotoxin
74
39
0
0
X
 
 
18509
Cu(I),Zn(II) superoxide dismutase
136
245
136
0
X
 
 
18508
beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrin
596
395
106
0
X
 
 
18507
beta2 carbohydrate module of AMP-activated protein kinase
601
397
103
0
X
 
 
18506
Tg Micronemal Protein 5
138
0
0
0
X
 
 
18505
MHV N NTD
610
422
122
0
X
 
 
18504
pfsub2
500
471
118
0
X
 
 
18503
RNA (49-MER)
338
234
64
0
 
 
X
18502
Smurf2 WW3 domain in complex with a Smad7 derived peptide
256
0
0
0
X
 
 
18501
NEDD4L WW2 domain in complex with a Smad7 derived peptide
303
0
0
0
X
 
 
18500
Smurf1 WW2 domain in complex with a Smad7 derived peptide
249
0
0
0
X
 
 
18499
YAP WW1 in complex with a Smad7 derived peptide
241
0
0
0
X
 
 
18498
YAP WW2 in complex with a Smad7 derived peptide
249
0
0
0
X
 
 
18497
autoinhibitory domain of human AMP-activated protein kinase catalytic subunit
303
231
62
0
X
 
 
18496
YdbC:dT19G1 complex
575
330
70
0
X
X
 
18495
Th205-316 dimer
626
1
0
0
X
 
 
18494
TM0026 monomer
59
171
59
0
X
 
 
18493
DsbB C41S
67
552
125
0
X
 
 
18492
SANT2 domain of NCoR2
410
287
71
0
X
 
 
18491
Th255-316 dimer
362
0
0
0
X
 
 
18490
TDRD3 complex
290
176
53
0
X
 
 
18489
HR2876B
597
448
90
0
X
 
 
18488
Oxydizied Sulfiredoxin C106V
451
435
97
0
X
 
 
18487
YR313A
668
386
119
0
X
 
 
18486
Reduced Sulfiredoxin
479
356
108
0
X
 
 
18485
Tb 1-C-Grx1 monomer
662
496
103
0
X
 
 
18484
G5
545
309
101
0
X
 
 
18481
ASTEXIN1
141
0
0
0
X
 
 
18480
major ampullate spidroin 1 N-terminal domain
737
537
152
0
X
 
 
18479
HRas166
159
469
158
0
X
 
 
18478
P75/LEDGF PWWP Domain
420
329
81
0
X
 
 
18477
A.fAglB_S2
151
0
151
0
X
 
 
18475
P2_gpX
359
208
68
0
X
 
 
18474
pwwp domain of TFIIS2-1
495
295
107
0
X
 
 
18473
L-PGDS/U-46619 complex
675
432
143
0
X
 
 
18471
PWWP_domain
549
298
101
0
X
 
 
18469
YdbC
458
338
77
0
X
 
 
18468
PaT415
482
370
76
0
X
 
 
18467
FAS1-4_R555W
655
514
132
0
X
 
 
18466
Wild-type FAS1-4
662
498
129
0
X
 
 
18465
OR157
678
483
105
0
X
 
 
18464
NCX3
737
572
135
0
X
 
 
18463
Eurocin
192
91
6
0
X
 
 
18462
Kaiso
1176
607
164
0
X
X
 
18461
H-Ras-GppNHp
162
163
162
0
X
 
 
18459
N0 domain of Neisseria meningitidis Pilus assembly protein PilQ
711
518
133
0
X
 
 
18458
HIRAN domain
691
354
118
0
X
 
 
18455
REV1-CT
524
380
98
0
X
 
 
18454
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
18453
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
18452
Synthetic cyclic oligonucleotide
116
0
0
0
X
X
 
18449
SBM
205
101
34
0
X
 
 
18448
NIPP1 1-143
121
258
121
0
X
 
 
18447
yeast Tah1 in complex with the Hsp90 C-terminal tail
680
346
119
0
X
 
 
18446
Apoform of Hahellin
71
222
71
0
X
 
 
18445
yeast Tah1
644
327
0
0
X
 
 
18443
thioredoxin
712
547
121
0
X
 
 
18442
R. rickettsii cold shock-like protein
413
293
77
0
X
 
 
18441
harmonin
587
322
91
0
X
 
 
18440
Analog of the fragment 197-221 of 1- adrenoreceptor
139
63
0
0
X
 
 
18439
BRD4 second bromodomain with NF-kB-K310ac peptide
748
444
117
0
X
 
 
18438
HR7057A
515
372
88
0
X
 
 
18437
gpFI C-terminal domain
319
187
60
0
X
 
 
18435
C-terminal domain of Tetrahymena telomerase protein p65
666
532
121
0
X
 
 
18434
C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)
509
382
97
0
X
 
 
18433
mouse Rev1 CTD in complex with the RIR of Pol Kappa
796
460
132
0
X
 
 
18432
Rev1
701
520
119
0
X
 
 
18431
mouse Rev1 C-terminal domain
618
363
100
0
X
 
 
18430
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
149
0
0
0
 
X
 
18429
OR188
611
435
95
0
X
 
 
18428
PilQ
781
721
209
0
X
 
 
18427
2'F-ANA and ANA self-complementary duplex
72
0
0
0
 
X
 
18426
human prion protein
810
461
150
0
X
 
 
18425
S100A11 dimer
406
353
87
0
X
 
 
18424
holoprotein
333
0
135
0
X
 
 
18423
holoprotein
348
0
135
0
X
 
 
18422
holoprotein
409
348
134
0
X
 
 
18421
eiavCA monomer
188
588
185
0
X
 
 
18420
magainin
53
0
0
0
X
 
 
18419
B2 domain of Neisseria meningitidis Pilus assembly protein PilQ
689
529
124
0
X
 
 
18418
pleurocidin
120
0
0
0
X
 
 
18417
H6-hBASP1
969
798
240
0
X
 
 
18416
ubiquitin homology of mouse BAG-1
528
383
96
0
X
 
 
18415
human C-type lectin domain family 4 member D
923
673
169
0
X
 
 
18414
AdcR
195
475
139
0
X
 
 
18413
AdcR
176
434
131
0
X
 
 
18412
phosphoprotein enriched in astrocytes 15A
708
472
132
0
X
 
 
18411
putative protein disulfide isomerase
908
695
147
0
X
 
 
18410
third transmembrane domain from the human copper transport 1
121
0
0
0
X
 
 
18409
second transmembrane domain from human copper transport 1
172
0
0
0
X
 
 
18408
first transmembrane domain from human copper transport 1
131
0
0
0
X
 
 
18405
Sviceucin
97
58
0
0
X
 
 
18404
Target Recognition Domain of Zoocin A
631
501
141
0
X
 
 
18403
UIM-SH3 monomer
104
194
104
0
X
 
 
18400
CTD-StpA
270
182
43
0
X
 
 
18399
ubiqutin-like protein from Trypanosoma bucei
377
224
77
0
X
 
 
18398
WNK1 Autoinhibitory Domain
602
438
97
0
X
 
 
18397
GB1
66
186
61
0
X
 
 
18396
nanocrystalline DsbA
140
427
138
0
X
 
 
18395
DsbB
67
132
67
0
X
 
 
18394
uncharacterized thioredoxin-like protein BVU_1432
875
662
157
0
X
 
 
18393
dsRBD
405
309
67
0
X
 
 
18392
EIC dimer
266
810
266
0
X
 
 
18391
R3H domain from human Smubp-2 in complex with 2'-deoxyguanosine-5'-monophosphate
417
0
75
0
X
 
 
18390
Fr822A
414
321
78
0
X
 
 
18389
CtCBM11
848
619
173
0
X
 
 
18388
CtCBM11
941
690
176
0
X
 
 
18387
thiol:disulfide interchange protein
874
676
149
0
X
 
 
18386
HP1 CSDalpha(109-185)
72
0
70
0
X
 
 
18385
H3(1-59)
55
0
55
0
X
 
 
18381
IscU-HscA
71
219
71
0
X
 
 
18380
dvCcmE'
296
270
93
0
X
 
 
18379
IIA(chb)-HPr complex
854
689
181
0
X
 
 
18378
Liraglutide
162
0
0
0
X
 
 
18377
MTIP(61-204)
142
423
142
0
X
 
 
18376
MTIP(61-204)
137
422
137
0
X
 
 
18375
staphyloxanthin_protein
577
433
119
0
X
 
 
18374
AIRE-PHD2
327
192
62
0
X
 
 
18373
bLAC
229
444
229
0
X
 
 
18372
OR137
867
612
141
0
X
 
 
18371
EB1 C-terminal domain
67
177
67
0
X
 
 
18370
W123G
125
0
125
0
X
 
 
18369
W111G
122
0
122
0
X
 
 
18368
W108G
121
0
121
0
X
 
 
18367
W62G
116
0
116
0
X
 
 
18366
W28G
125
0
125
0
X
 
 
18365
WT-ALA
429
363
125
0
X
 
 
18364
GS13500A_assembly
658
392
130
0
X
 
 
18363
Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptide
144
48
22
0
X
 
 
18362
IscU(S107A)
92
263
90
0
X
 
 
18361
IscU(N90A)
87
258
87
0
X
 
 
18360
IscU(E111A)
80
243
80
0
X
 
 
18359
IscU(D39V)
102
306
102
0
X
 
 
18358
dimeric Acanthaporin
185
0
43
0
X
 
 
18357
Acanthaporin
247
0
0
0
X
 
 
18356
ADF like UNC-60A Protein
946
719
162
0
X
 
 
18355
Rv0603-SSD
389
308
76
0
X
 
 
18354
conotoxin_TIA
131
0
0
0
X
 
 
18353
Kelch domain of mouse Keap1
251
490
251
0
X
 
 
18352
HR8150A
433
308
70
0
X
 
 
18351
MS3
410
308
79
0
X
 
 
18350
cathelicidin-PY
148
0
0
0
X
 
 
18349
RF2209A
510
294
88
0
X
 
 
18348
EB1 CH domain
126
367
126
0
X
 
 
18347
micasin
201
0
0
0
X
 
 
18346
NP_390037.1 from Bacillus subtilis
776
432
141
0
X
 
 
18345
anti-fungal defensin DEF4 (MTR_8g070770)
238
22
48
0
X
 
 
18344
assembly
192
487
177
0
X
 
 
18342
Get5_UBL domain
479
383
82
0
X
 
 
18341
Sgt2_NT homodimer
439
329
82
0
X
 
 
18340
Bax+vMIA
106
38
11
0
X
 
 
18339
FTSA
324
1049
324
0
X
 
 
18338
PPc
529
368
102
0
X
 
 
18337
OR136
859
609
140
0
X
 
 
18336
RNA_(27-MER)
209
69
9
0
 
 
X
18335
gH625-644
87
0
0
0
X
 
 
18334
trypsin inhibitor BWI-2c
268
21
45
0
X
 
 
18333
phosphorylated CRKL
837
701
235
0
X
 
 
18332
Escherichia coli Porins
382
239
67
0
X
 
 
18331
MS1
453
338
83
0
X
 
 
18329
DBPA
746
633
156
0
X
 
 
18328
CHCHD7
377
273
74
0
X
 
 
18327
atypical SH3 domain of DOCK180
314
177
57
0
X
 
 
18326
Ni(II)-bound NmtR homedimer
81
69
81
0
X
 
 
18325
oxidized_Mrx1
462
368
88
0
X
 
 
18324
TAR RNA binding protein 2 (19-228)
192
589
192
0
X
 
 
18323
calcium-bound CaM C-terminal domain in a complex
224
261
68
0
X
 
 
18322
reduced_Mrx1
467
370
90
0
X
 
 
18321
CRKL
870
882
232
0
X
 
 
18320
PhoRadA intein
984
708
162
0
X
 
 
18319
Y4_TM1-TM2
669
479
120
0
X
 
 
18318
CHCH5
271
264
73
0
X
 
 
18317
sugarcane cystatin
590
419
116
0
X
 
 
18316
C-terminal domain of the MgtC protein
190
264
89
0
X
 
 
18315
FOXO3a
725
512
124
0
X
 
 
18314
FOXO3a
726
512
124
0
X
 
 
18313
A domain of talin
750
552
145
0
X
 
 
18312
PiCyp_A
755
665
171
0
X
 
 
18310
FliGn-FliFc
103
311
103
0
X
 
 
18309
FliGn homodimer
91
191
91
0
X
 
 
18307
A2POBEC2 1-224
198
387
198
0
X
 
 
18306
A2POBEC2 41-224
158
466
158
0
X
 
 
18303
PfPMT
1125
893
253
0
X
 
 
18302
calcium-bound CaM N-terminal domain in a complex
447
364
95
0
X
 
 
18301
MBD2
339
281
69
0
X
 
 
18300
Solution NMR structure of asteropusin A from marine sponge Asteropus sp.
202
118
0
0
X
 
 
18299
K60A mutant of Atox1
316
259
68
0
X
 
 
18298
NusG
989
549
147
0
X
 
 
18297
Uba3
485
367
82
0
X
 
 
18296
BRD1_PHD2_finger
441
289
77
0
X
 
 
18295
Granulocyte colony-stimulating factor A37G
155
471
153
0
X
 
 
18294
Granulocyte colony-stimulating factor A30G
159
475
155
0
X
 
 
18293
Granulocyte colony-stimulating factor A29G
157
476
156
0
X
 
 
18292
RBM39
622
476
120
0
X
 
 
18291
Granulocyte colony-stimulating factor
157
475
155
0
X
 
 
18290
SnR212
601
445
115
0
X
 
 
18289
antifreeze_peptide_4m
69
0
0
0
X
 
 
18288
Ninjurin1 monomer
228
233
73
0
X
 
 
18287
PAP248-286
195
0
0
0
X
 
 
18286
antifreeze_peptide_3
90
0
0
0
X
 
 
18284
antifreeze_peptide_1m
94
0
0
0
X
 
 
18283
YmgD dimer
476
342
96
0
X
 
 
18282
M-PMV MYRISTOYLATED MATRIX PROTEIN
441
419
103
0
X
 
 
18281
Strawberry
808
609
144
0
X
 
 
18280
CD81 LEL
85
257
85
0
X
 
 
18279
human CEB25 minisatellite G-quadruplex
233
56
0
25
 
X
 
18278
FKBP12 from Aedes aegypti
585
423
104
0
X
 
 
18277
KmAtg10
909
688
162
0
X
 
 
18276
PrgI needle
74
380
85
0
X
 
 
18269
N-terminal domain of human CDNF
574
360
98
0
X
 
 
18268
EF-hand_domain_of_polycystin-2
159
145
72
0
X
 
 
18267
DNA Polymerase beta uncomplexed
260
802
260
0
X
 
 
18266
Dengue Virus NS2B/NS3 in complex with Aprotinin
172
530
172
0
X
 
 
18263
RPA2022
554
436
102
0
X
 
 
18262
Major_ampullate_spidroin_1
712
418
142
0
X
 
 
18261
A72R
719
542
142
0
X
 
 
18260
R17
638
483
122
0
X
 
 
18257
DmsD
168
534
167
0
X
 
 
18256
monomeric phospholamban (C36A, C41F, C46A)
101
152
50
0
X
 
 
18255
MbtH-like protein
435
339
84
0
X
 
 
18254
apo-azurin
107
0
107
0
X
 
 
18253
P1 endolysin Lyz
675
608
176
0
X
 
 
18250
Bcl-XL
948
733
183
0
X
 
 
18249
CcmG
807
639
156
0
X
 
 
18248
ThrRS-dTP(2-60)
231
49
51
0
X
 
 
18246
porcine pepsin
303
928
303
0
X
 
 
18245
porcine pepsin
291
613
291
0
X
 
 
18244
complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15
639
487
102
0
X
 
 
18243
alpha-synuclein fibrils
49
127
48
0
X
 
 
18242
PYNOD PYD
581
428
93
0
X
 
 
18240
Mutant of the sub-genomic promoter from Brome Mosaic Virus
100
0
0
14
 
 
X
18239
RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP*AP*UP*CP*UP*UP*C)-3')
105
0
0
15
 
 
X
18238
APOPTOSIS ACTIVATING PHOTOSWITCHABLE BAK PEPTIDE BOUND to BCL-XL
943
636
183
0
X
 
 
18237
gp41-M-MAT
223
152
64
0
X
 
 
18236
cruzain
197
631
182
0
X
 
 
18235
N-dre2
713
466
127
0
X
 
 
18234
P1-CheY/P2 complex
108
0
108
0
X
 
 
18231
S100A1 homodimer
512
380
91
0
X
 
 
18230
S100A1 dimer
517
349
95
0
X
 
 
18229
complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2
926
690
173
0
X
 
 
18228
TpbA monomer
985
542
172
0
X
 
 
18227
MS1
338
271
70
0
X
 
 
18226
MS1
324
267
70
0
X
 
 
18225
MS1
342
281
70
0
X
 
 
18224
MS1
323
271
70
0
X
 
 
18223
TMEM14C
151
257
101
0
X
 
 
18222
TMEM141
281
197
103
0
X
 
 
18221
FAM14B
330
350
107
0
X
 
 
18220
TMEM14A
312
350
97
0
X
 
 
18219
TMEM14A
312
350
97
0
X
 
 
18218
HIGD1B
440
351
94
0
X
 
 
18217
HIGD1A
195
204
71
0
X
 
 
18216
acyl-carrier protein from Rickettsia prowazekii
405
350
78
0
X
 
 
18215
HsR50
829
704
169
0
X
 
 
18214
tstm1273
363
259
61
0
X
 
 
18211
Lotus domains 2 and 3
1140
834
179
0
X
 
 
18210
Conotoxin analogue [D-Ala2]BuIIIB
671
573
96
0
X
 
 
18209
DNA_molecule_G3ATG3ACACAG4ACG3
153
0
0
0
 
X
 
18206
Conotoxin analogue [D-Ala2]BuIIIB
141
71
25
0
X
 
 
18204
hPEBP1
167
531
167
0
X
 
 
18203
Mu-contoxin BuIIIB
141
70
30
0
X
 
 
18202
hNaa50p
140
544
140
0
X
 
 
18201
HasR N-terminal periplasmic signaling domain
525
403
107
0
X
 
 
18200
RstA_C
541
389
103
0
X
 
 
18199
DNA_1
48
0
0
0
 
X
 
18198
NIPP1 monomer
81
167
81
0
X
 
 
18197
angiogenin monomer
667
482
123
0
X
 
 
18196
proteinase inhibitor
495
451
124
0
X
 
 
18195
optn 550
141
98
32
0
X
 
 
18194
CarD1-72
404
296
73
0
X
 
 
18193
TtCdnLNt
391
278
58
0
X
 
 
18192
SGF73
218
175
44
0
X
 
 
18191
SGF11
204
144
45
0
X
 
 
18190
BC008182
431
244
75
0
X
 
 
18189
DocA
361
266
76
0
X
 
 
18188
CohA2
810
640
151
0
X
 
 
18187
Get5 carboxyl domain from A. fumigatus
378
321
75
0
X
 
 
18186
Get5 carboxyl domain from S. cerevisiae
361
270
65
0
X
 
 
18185
VHS-UIM monomer
165
0
165
0
X
 
 
18183
Vav2
713
431
116
0
X
 
 
18182
Vav2 and Arap3
768
455
111
0
X
 
 
18181
GspC-HR of typeII secretion system
398
260
72
0
X
 
 
18180
HmR11
1057
803
197
0
X
 
 
18179
E60A mutant AGR2
517
424
110
0
X
 
 
18178
AGR2 residues 41-175
199
480
135
0
X
 
 
18177
cytosolic region of human VIMP
81
241
81
0
X
 
 
18176
cytosolic region of human VIMP
81
169
81
0
X
 
 
18171
atTic-hip/hop domain (Residue 310-371)
371
262
67
0
X
 
 
18169
Ca-bound S100A4 in complex with non-muscle myosin IIA
1438
914
204
0
X
 
 
18167
PsbP
908
647
177
0
X
 
 
18166
HR4403E
791
560
141
0
X
 
 
18165
Enterohaemorrhagic E. coli (EHEC)
1001
584
158
0
X
 
 
18164
Neurotensin
97
0
0
0
X
 
 
18163
Neurotensin
96
0
0
0
X
 
 
18162
Neurotensin
98
0
0
0
X
 
 
18161
OR134
626
458
108
0
X
 
 
18160
SB2Jalpha
182
0
0
0
X
 
 
18159
SB1Jalpha
153
0
0
0
X
 
 
18158
N-terminal domain (6-74) of human ZBP1 protein
433
317
75
0
X
 
 
18157
Avh5
103
323
103
0
X
 
 
18156
HR6741A
555
420
101
0
X
 
 
18155
Neurolin Ig2
617
476
107
0
X
 
 
18154
YqcA from Escherichia coli
761
560
137
0
X
 
 
18153
thermomacin
282
125
67
0
X
 
 
18152
BA_SrtD
645
525
121
0
X
 
 
18151
CdnL
892
539
166
0
X
 
 
18148
VEGFR-2
48
0
0
0
X
 
 
18147
RbfA
136
393
136
0
X
 
 
18146
coprisin
223
0
0
0
X
 
 
18145
OR135
492
351
85
0
X
 
 
18142
PHD zinc finger
609
392
105
0
X
 
 
18141
novel conotoxin im23a from Conus imperialis
253
29
43
0
X
 
 
18138
MDR 769 homodimer
88
177
88
0
X
 
 
18137
Fam96a
103
460
105
0
X
 
 
18135
GLYCOSYLATED HUMAN INTERFERON ALPHA-2A [WITH GALNAC AT THR 106]
1007
731
178
0
X
 
 
18134
FIRST SAM DOMAIN OF ODIN
464
244
81
0
X
 
 
18133
AK1
858
777
187
0
X
 
 
18132
THERMOSTABLE PROTEIN FROM HYPERTHERMOPHILIC VIRUS SSV-RH
269
171
69
0
X
 
 
18130
monomeric Pstrx2
598
476
106
0
X
 
 
18126
Z-L2LBT
73
223
73
0
X
 
 
18125
avidin
705
418
120
0
X
 
 
18124
D. radiodurans RecQ
418
287
71
0
X
 
 
18123
avidin
122
212
118
0
X
 
 
18122
Photoactive Yellow Protein
597
544
132
0
X
 
 
18121
CdnL N-terminal domain
408
271
70
0
X
 
 
18119
ITK-SH3
395
276
67
0
X
 
 
18118
BC040485
589
336
113
0
X
 
 
18115
C-terminal Domain (537-610) of Human Heat Shock Protein 70
406
310
78
0
X
 
 
18114
human LL-23
156
59
22
0
X
 
 
18113
allergenic beta parvalbumin
559
418
105
0
X
 
 
18112
HR4660B
522
530
146
0
X
 
 
18111
T7 transcription factor Gp2-E. coli RNAp jaw domain complex
634
499
113
0
X
 
 
18110
C-terminal RAGE (ctRAGE)
214
107
40
0
X
 
 
18109
MmpS4
73
227
73
0
X
 
 
18107
a major allergen from dust mite
529
291
94
0
X
 
 
18106
S25p-mAb3c3
104
0
0
0
X
 
 
18105
S25p
104
0
0
0
X
 
 
18104
S25up
91
0
0
0
X
 
 
18103
G_protein_alphai3_subunit
337
1000
337
0
X
 
 
18102
Cysteine Deleted Analog of Tachyplesin-1
84
0
0
0
X
 
 
18101
S100A1
473
371
90
0
X
 
 
18099
CIB1
229
591
159
0
X
 
 
18098
YT682A
682
488
111
0
X
 
 
18097
rhesus SPRY domain
319
326
143
0
X
 
 
18096
nAChR
630
552
127
0
X
 
 
18095
FR824D
636
464
112
0
X
 
 
18094
AF4-Af9 fusion
601
446
108
0
X
 
 
18093
transmembrane domains of the a4b2 nAChR
651
567
127
0
X
 
 
18092
NeRF1
837
522
152
0
X
 
 
18091
DP2
434
307
76
0
X
 
 
18090
DP1
448
321
76
0
X
 
 
18089
Post-translational S-nitrosylation
543
320
100
0
X
 
 
18088
Post-translational S-nitrosylation
542
321
100
0
X
 
 
18087
S100A1C85M
546
396
95
0
X
 
 
18086
YjdK
600
304
103
0
X
 
 
18085
Alvinellacin
83
0
0
0
X
 
 
18084
Calmodulin C-lobe bound with ER alpha peptide
244
129
67
0
X
 
 
18083
THP type 1 alpha 1 collagen fragment (772-786)
219
165
45
0
X
 
 
18082
Calmodulin N-lobe bound with ER alpha peptide
283
157
78
0
X
 
 
18081
apoCuA_polypeptide
646
477
117
0
X
 
 
18080
amyloid precursor protein's transmembrane domain
0
0
0
0
 
 
 
18079
UNAC Tetraloops
90
0
0
0
 
 
X
18078
AbpSH3-Srv17
65
0
65
0
X
 
 
18077
AbpSH3-Srv12
65
0
65
0
X
 
 
18076