BMRB Entry 11438
Click here to enlarge.
PDB ID: 2rrr
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR11438
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer PubMed: 21443191
Deposition date: 2011-03-24 Original release date: 2011-06-22
Authors: Furuita, Kyoko; Murata, Shunpei; Jee, JunGoo; Ichikawa, Satoshi; Matsuda, Akira; Kojima, Chojiro
Citation: Furuita, Kyoko; Murata, Shunpei; Jee, JunGoo; Ichikawa, Satoshi; Matsuda, Akira; Kojima, Chojiro. "Structural Feature of Bent DNA Recognized by HMGB1" J. Am. Chem. Soc. 133, 5788-5790 (2011).
Assembly members:
Ethylene-DNA, polymer, 28 residues, 111.103 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Ethylene-DNA: CCTTCATTACATCCGGATGT
AATGAAGG
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 211 |