BMRB Entry 15080
Click here to enlarge.
PDB ID: 2o32
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15080
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: U2 snRNA stem I from S. cerevisiae PubMed: 17242306
Deposition date: 2006-12-15 Original release date: 2007-02-02
Authors: Sashital, Dipali; Venditti, Vincenzo; Angers, Cortney; Cornilescu, Gabriel; Butcher, Samuel
Citation: Sashital, Dipali; Venditti, Vincenzo; Angers, Cortney; Cornilescu, Gabriel; Butcher, Samuel. "Structure and thermodynamics of a conserved U2 snRNA domain from yeast and human" RNA 13, 328-338 (2007).
Assembly members:
Yeast_U2_Stem_I, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Yeast_U2_Stem_I: GGUUUGCCUUUUGGCUUACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 133 |
| 1H chemical shifts | 177 |