BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15417

Title: Solution Structure of the Frameshift-Inducing RNA Stem-Loop in SIV   PubMed: 17868691

Deposition date: 2007-08-04 Original release date: 2007-09-18

Authors: Marcheschi, Ryan; Staple, David; Butcher, Samuel

Citation: Marcheschi, Ryan; Staple, David; Butcher, Samuel. "Programmed Ribosomal Frameshifting in SIV is Induced by a Highly Structured RNA Stem-Loop"  J. Mol. Biol. 373, 652-663 (2007).

Assembly members:
SIV_RNA_(34-MER), polymer, 34 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
SIV_RNA_(34-MER): GGAUGGGGAAAGAAGCCCCG CAAUUUCCCCAUCC

Data sets:
Data typeCount
13C chemical shifts137
15N chemical shifts11
1H chemical shifts249

Time Domain Data

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all