BMRB Entry 15417
Click here to enlarge.
PDB ID: 2jtp
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15417
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution Structure of the Frameshift-Inducing RNA Stem-Loop in SIV PubMed: 17868691
Deposition date: 2007-08-04 Original release date: 2007-09-18
Authors: Marcheschi, Ryan; Staple, David; Butcher, Samuel
Citation: Marcheschi, Ryan; Staple, David; Butcher, Samuel. "Programmed Ribosomal Frameshifting in SIV is Induced by a Highly Structured RNA Stem-Loop" J. Mol. Biol. 373, 652-663 (2007).
Assembly members:
SIV_RNA_(34-MER), polymer, 34 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
SIV_RNA_(34-MER): GGAUGGGGAAAGAAGCCCCG
CAAUUUCCCCAUCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 137 |
15N chemical shifts | 11 |
1H chemical shifts | 249 |