BMRB Entry 15697
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15697
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Mutational and Structural Analysis of Stem-loop IIId of the Hepatitis C Virus and GB Virus B Internal Ribosome Entry Sites
Deposition date: 2008-03-28 Original release date: 2009-10-13
Authors: Thiviyanathan, Varatharasa; Kulasegaran, Raghav; Kaluarachchi, Kumaralal; Gorenstein, David
Citation: Thiviyanathan, Varatharasa; Kulasegaran, Raghav; Kaluarachchi, Kumaralal; Rijnbrand, Rene; Gorenstein, David. "Mutational and Structural Analysis of Stem-loop IIId of the Hepatitis C Virus and GB Virus B Internal Ribosome Entry Sites" J. Virology ., .-..
Assembly members:
GBV_B_IRES, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: GB virus B Taxonomy ID: 39113 Superkingdom: Viruses Kingdom: not available Genus/species: not available GB virus B
Experimental source: Production method: enzymatic synthesis
Entity Sequences (FASTA):
GBV_B_IRES: GGAUGGUUGGGGUUAGCCAU
CC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 179 |