BMRB Entry 15856
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15856
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)
Deposition date: 2008-07-04 Original release date: 2009-10-13
Authors: Kruschel, Daniela; Sigel, Roland
Citation: Kruschel, Daniela; Sigel, Roland. "Solution structure of the 5'-splice site of a group II intron ribozyme" Not known ., .-..
Assembly members:
RNA_(29-MER), polymer, 29 residues, Formula weight is not available
Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: in vitro transcription Host organism: Saccharomyces cerevisiae
Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA
GCAUACUCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 77 |
15N chemical shifts | 10 |
1H chemical shifts | 221 |