BMRB Entry 15857

Name: NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)
Published: 2009-10-13

Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15857

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title: NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)

Deposition date: 2008-07-04 Original release date: 2009-10-13

Authors: Kruschel, Daniela; Sigel, Roland

Citation: Kruschel, Daniela; Sigel, Roland. "Solution structure of the 5'-splice site of a group II intron ribozyme" Not known ., .-..

Assembly members:
RNA_(29-MER), polymer, 29 residues, Formula weight is not available
RNA_(7-MER), polymer, 7 residues, Formula weight is not available

Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi

Experimental source: Production method: in vitro transcription Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA GCAUACUCC
RNA_(7-MER): CAGUGUC

Data sets:

assigned_chemical_shifts
- assigned_chem_shift_list_1

Data type	Count
13C chemical shifts	77
15N chemical shifts	13
1H chemical shifts	306

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Entity Assembly ID	Entity Name	Entity ID
1	RNA (29-MER)	1
2	RNA (7-MER)	2

Samples:

sample_1: RNA (29-MER) 0.5-0.9 mM; RNA (7-MER) 0.5-0.9 mM; potassium chloride 110 mM; EDTA 10 uM; MgCl2 0-10 mM; D2O, [U-100% 2H], 100%

sample_2: RNA (29-MER) 0.5-0.9 mM; RNA (7-MER) 0.5-0.9 mM; potassium chloride 110 mM; EDTA 10 uM; MgCl2 0-8 mM; H2O 90%; D2O, [U-100% 2H], 10%

sample_3: RNA (29-MER), [selectively deuterated at 3, ; 2, RNA (7-MER), ; 3, potassium chloride, ; 4, EDTA, ; 5, D2O, ;

sample_4: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.5 mM; RNA (7-MER) 0.5 mM; potassium chloride 50 mM; EDTA 10 uM; H2O 90%; D2O, [U-100% 2H], 10%

sample_5: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.5 mM; RNA (7-MER) 0.5 mM; potassium chloride 50 uM; EDTA 10 uM; Pf1 phage 25.6 mg/ml; H2O 90%; D2O, [U-100% 2H], 10%

sample_conditions_1: ionic strength: 115 mM; pD: 6.8; pressure: 1 atm; temperature: 288 K

sample_conditions_5: ionic strength: 115 mM; pD: 6.8; pressure: 1 atm; temperature: 293 K

sample_conditions_6: ionic strength: 115 mM; pD: 6.8; pressure: 1 atm; temperature: 298 K

sample_conditions_7: ionic strength: 1105 mM; pD: 6.8; pressure: 1 atm; temperature: 303 K

sample_conditions_2: ionic strength: 114 mM; pH: 6.65; pressure: 1 atm; temperature: 278 K

sample_conditions_8: ionic strength: 114 mM; pH: 6.65; pressure: 1 atm; temperature: 293 K

sample_conditions_3: ionic strength: 110 mM; pD: 6.6; pressure: 1 atm; temperature: 298 K

sample_conditions_4: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 278 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D 1H-1H NOESY	sample_1	isotropic	sample_conditions_1
2D 1H-1H TOCSY	sample_1	isotropic	sample_conditions_1
2D 1H-1H NOESY	sample_2	isotropic	sample_conditions_2
2D 1H-1H NOESY	sample_3	isotropic	sample_conditions_3
2D 1H-13C HSQC	sample_4	isotropic	sample_conditions_3
2D 1H-15N HSQC	sample_4	isotropic	sample_conditions_4
2D 1H-13C HSQC	sample_5	anisotropic	sample_conditions_3
2D 1H-15N HSQC	sample_5	anisotropic	sample_conditions_4
2D JNN HNN-COSY	sample_4	isotropic	sample_conditions_4
3D X filtered NOESY-15NHSQC	sample_4	isotropic	sample_conditions_4
2D X filtered NOESY	sample_4	isotropic	sample_conditions_3
2D X filtered TOCSY	sample_4	isotropic	sample_conditions_3

Biological Magnetic Resonance Data Bank

BMRB Entry 15857

Title: NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)

Additional metadata:

Assembly:

Entities:

Samples:

Experiments:

Software:

NMR spectrometers: