BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15857

Title: NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)

Deposition date: 2008-07-04 Original release date: 2009-10-13

Authors: Kruschel, Daniela; Sigel, Roland

Citation: Kruschel, Daniela; Sigel, Roland. "Solution structure of the 5'-splice site of a group II intron ribozyme"  Not known ., .-..

Assembly members:
RNA_(29-MER), polymer, 29 residues, Formula weight is not available
RNA_(7-MER), polymer, 7 residues, Formula weight is not available

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: in vitro transcription   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA GCAUACUCC
RNA_(7-MER): CAGUGUC

Data sets:
Data typeCount
13C chemical shifts77
15N chemical shifts13
1H chemical shifts306

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (29-MER)1
2RNA (7-MER)2

Entities:

Entity 1, RNA (29-MER) 29 residues - Formula weight is not available

1   GGAGUAUGUA
2   UUGGCACUGA
3   GCAUACUCC

Entity 2, RNA (7-MER) 7 residues - Formula weight is not available

1   CAGUGUC

Samples:

sample_1: RNA (29-MER) 0.5-0.9 mM; RNA (7-MER) 0.5-0.9 mM; potassium chloride 110 mM; EDTA 10 uM; MgCl2 0-10 mM; D2O, [U-100% 2H], 100%

sample_2: RNA (29-MER) 0.5-0.9 mM; RNA (7-MER) 0.5-0.9 mM; potassium chloride 110 mM; EDTA 10 uM; MgCl2 0-8 mM; H2O 90%; D2O, [U-100% 2H], 10%

sample_3: RNA (29-MER), [selectively deuterated at 3, ; 2, RNA (7-MER), ; 3, potassium chloride, ; 4, EDTA, ; 5, D2O, ;

sample_4: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.5 mM; RNA (7-MER) 0.5 mM; potassium chloride 50 mM; EDTA 10 uM; H2O 90%; D2O, [U-100% 2H], 10%

sample_5: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.5 mM; RNA (7-MER) 0.5 mM; potassium chloride 50 uM; EDTA 10 uM; Pf1 phage 25.6 mg/ml; H2O 90%; D2O, [U-100% 2H], 10%

sample_conditions_1: ionic strength: 115 mM; pD: 6.8; pressure: 1 atm; temperature: 288 K

sample_conditions_5: ionic strength: 115 mM; pD: 6.8; pressure: 1 atm; temperature: 293 K

sample_conditions_6: ionic strength: 115 mM; pD: 6.8; pressure: 1 atm; temperature: 298 K

sample_conditions_7: ionic strength: 1105 mM; pD: 6.8; pressure: 1 atm; temperature: 303 K

sample_conditions_2: ionic strength: 114 mM; pH: 6.65; pressure: 1 atm; temperature: 278 K

sample_conditions_8: ionic strength: 114 mM; pH: 6.65; pressure: 1 atm; temperature: 293 K

sample_conditions_3: ionic strength: 110 mM; pD: 6.6; pressure: 1 atm; temperature: 298 K

sample_conditions_4: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_3isotropicsample_conditions_3
2D 1H-13C HSQCsample_4isotropicsample_conditions_3
2D 1H-15N HSQCsample_4isotropicsample_conditions_4
2D 1H-13C HSQCsample_5anisotropicsample_conditions_3
2D 1H-15N HSQCsample_5anisotropicsample_conditions_4
2D JNN HNN-COSYsample_4isotropicsample_conditions_4
3D X filtered NOESY-15NHSQCsample_4isotropicsample_conditions_4
2D X filtered NOESYsample_4isotropicsample_conditions_3
2D X filtered TOCSYsample_4isotropicsample_conditions_3

Software:

TOPSPIN v1.3, 2.0, 2.1, Bruker Biospin - processing

SPARKY v3.1, Goddard - chemical shift assignment, data analysis, peak picking

DYANA v1.5, Guntert, Braun and Wuthrich - structure solution

CNSSOLVE v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

X-PLOR NIH v2.16, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker Avance 700 MHz