BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15859

Title: NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)

Deposition date: 2008-07-04 Original release date: 2009-10-13

Authors: Kruschel, Daniela; Sigel, Roland

Citation: Kruschel, Daniela; Sigel, Roland. "Solution structure of the 5'-splice site of a group II intron ribozyme"  Not known ., .-..

Assembly members:
RNA_(22-MER), polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: Baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: in vitro transcription   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
RNA_(22-MER): GGAGUAUGUGAAAGCAUACU CC

Data sets:
Data typeCount
13C chemical shifts58
15N chemical shifts11
1H chemical shifts183

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all