BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15869

Title: NMR Assignments of HIV-2 TAR RNA   PubMed: 19636896

Deposition date: 2008-07-09 Original release date: 2008-10-15

Authors: Carlomagno, Teresa; Amata, Irene; Williamson, James

Citation: Carlomagno, Teresa; Amata, Irene; Williamson, James; Hennig, Mirko. "NMR Assignments of HIV-2 TAR RNA"  Biomol. NMR Assignments 2, 167-169 (2008).

Assembly members:
HIV-2_TAR, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: HIV   Taxonomy ID: 11709   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus Human immunodeficiency virus 2

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
HIV-2_TAR: GGCCAGAUUGAGCCUGGGAG CUCUCUGGCC

Data sets:
Data typeCount
13C chemical shifts270
15N chemical shifts47
1H chemical shifts272
31P chemical shifts29

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all