BMRB Entry 15869
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15869
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR Assignments of HIV-2 TAR RNA PubMed: 19636896
Deposition date: 2008-07-09 Original release date: 2008-10-15
Authors: Carlomagno, Teresa; Amata, Irene; Williamson, James
Citation: Carlomagno, Teresa; Amata, Irene; Williamson, James; Hennig, Mirko. "NMR Assignments of HIV-2 TAR RNA" Biomol. NMR Assignments 2, 167-169 (2008).
Assembly members:
HIV-2_TAR, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: HIV Taxonomy ID: 11709 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus Human immunodeficiency virus 2
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
HIV-2_TAR: GGCCAGAUUGAGCCUGGGAG
CUCUCUGGCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 270 |
15N chemical shifts | 47 |
1H chemical shifts | 272 |
31P chemical shifts | 29 |