BMRB Entry 16479
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16479
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 1H and 13C resonance assignments of a guanine sensing riboswitch's terminator hairpin PubMed: 20204714
Deposition date: 2009-09-04 Original release date: 2010-03-15
Authors: Ottink, Otmar; Westerweele, Ivo; Nelissen, Frank; Tessari, Marco; Heus, Hans; Wijmenga, Sybren
Citation: Ottink, Otmar; Westerweele, Ivo; Tesssari, Marco; Nelissen, Frank; Heus, Hans; Wijmenga, Sybren. "(1)H and (13)C resonance assignments of a guanine sensing riboswitch's terminator hairpin." Biomol. NMR Assignments 4, 89-91 (2010).
Assembly members:
G-riboswitch_terminator_hairpin, polymer, 35 residues, Formula weight is not available
Natural source: Common Name: Bacillus subtilis Taxonomy ID: 1423 Superkingdom: Bacteria Kingdom: not available Genus/species: Bacillus subtilis
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
G-riboswitch_terminator_hairpin: GGCAUUGCUUGCUCUUUAUU
UGAGCGGGCAAUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 90 |
| 1H chemical shifts | 119 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | subunit 1 | 1 |
Entities:
Entity 1, subunit 1 35 residues - Formula weight is not available
| 1 | G | G | C | A | U | U | G | C | U | U | ||||
| 2 | G | C | U | C | U | U | U | A | U | U | ||||
| 3 | U | G | A | G | C | G | G | G | C | A | ||||
| 4 | A | U | G | C | C |
Samples:
sample_1: G-riboswitch terminator hairpin 0.44 mM; D2O 7%; H2O 93%; NaPhosphate buffer (ph 6.7) 10 mM
sample_2: G-riboswitch terminator hairpin 0.44 mM; D2O 100%; NaPhosphate buffer (ph 6.7) 10 mM
sample_conditions_1: ionic strength: 10 mM; pH: 6.7; pressure: 1 atm; temperature: 288 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_1 |
Software:
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
SPARKY, Goddard - chemical shift assignment, peak picking
NMR spectrometers:
- Varian INOVA 800 MHz