BMRB Entry 16812
Click here to enlarge.
PDB ID: 2kae
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR16812
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: data-driven model of MED1:DNA complex PubMed: 19095651
Deposition date: 2010-03-31 Original release date: 2010-04-29
Authors: Lowry, Jason; Gamsjaeger, Roland; Thong, Sock Yue; Hung, Wendy; Kwan, Ann; Broitman-Maduro, Gina; Matthews, Jacqueline; Maduro, Morris; Mackay, Joel
Citation: Lowry, Jason; Gamsjaeger, Roland; Thong, Sock Yue; Hung, Wendy; Kwan, Ann; Broitman-Maduro, Gina; Matthews, Jacqueline; Maduro, Morris; Mackay, Joel. "Structural analysis of MED-1 reveals unexpected diversity in the mechanism of DNA recognition by GATA-type zinc finger domains." J. Biol. Chem. 284, 5827-5835 (2009).
Assembly members:
MED1zf, polymer, 65 residues, 6728.883 Da.
ZN, non-polymer, 65.409 Da.
DNA, polymer, . residues, Formula weight is not available
Natural source: Common Name: Caenorhabditis elegans Taxonomy ID: 6239 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Caenorhabditis elegans
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
MED1zf: KSFQCSNCSVTETIRWRNIR
SKEGIQCNACFIYQRKYNKT
RPVTAVNKYQKRKLKVQETN
GVDSF
DNA: CGGAAAAGTATACTTTTCCG
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 145 |
| 15N chemical shifts | 65 |
| 1H chemical shifts | 299 |
Additional metadata:
Related Database Links:
| PDB | 2KAE |
| EMBL | CAA92204 CCD72619 |
| GB | AAG21385 AAG21386 |
| REF | NP_498497 NP_510084 |
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts