BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16877

Title: Simultaneous recognition of HIV-1 TAR RNA bulge and loop sequences by cyclic peptide mimics of Tat protein   PubMed: 19584251

Deposition date: 2010-04-16 Original release date: 2010-04-29

Authors: Davidson, Amy; Leeper, Thomas; Varani, Gabriele

Citation: Davidson, Amy; Leeper, Thomas; Athanassiou, Zafiria; Patora-Komisarska, Krystyna; Karn, Jonathan; Robinson, John; Varani, Gabriele. "Simultaneous recognition of HIV-1 TAR RNA bulge and loop sequences by cyclic peptide mimics of Tat protein."  Proc. Natl. Acad. Sci. U.S.A. 106, 11931-11936 (2009).

Assembly members:
TAR, polymer, 29 residues, Formula weight is not available
TAT, polymer, 14 residues, Formula weight is not available

Natural source:   Common Name: AIDS virus   Taxonomy ID: 12721   Superkingdom: Virus   Kingdom: not available   Genus/species: Lentivirus not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
TAR: GGCAGAUCUGAGCCUGGGAG CUCUCUGCC
TAT: RVRTRKGRRIRIPP

Data sets:
Data typeCount
1H chemical shifts330

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all