BMRB Entry 16877
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16877
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Simultaneous recognition of HIV-1 TAR RNA bulge and loop sequences by cyclic peptide mimics of Tat protein PubMed: 19584251
Deposition date: 2010-04-16 Original release date: 2010-04-29
Authors: Davidson, Amy; Leeper, Thomas; Varani, Gabriele
Citation: Davidson, Amy; Leeper, Thomas; Athanassiou, Zafiria; Patora-Komisarska, Krystyna; Karn, Jonathan; Robinson, John; Varani, Gabriele. "Simultaneous recognition of HIV-1 TAR RNA bulge and loop sequences by cyclic peptide mimics of Tat protein." Proc. Natl. Acad. Sci. U.S.A. 106, 11931-11936 (2009).
Assembly members:
TAR, polymer, 29 residues, Formula weight is not available
TAT, polymer, 14 residues, Formula weight is not available
Natural source: Common Name: AIDS virus Taxonomy ID: 12721 Superkingdom: Virus Kingdom: not available Genus/species: Lentivirus not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
TAR: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
TAT: RVRTRKGRRIRIPP
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 330 |