BMRB Entry 16941
Click here to enlarge.
PDB ID: 2kx5
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16941
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Recognition of HIV TAR RNA by peptide mimetic of Tat protein PubMed: 20724442
Deposition date: 2010-05-20 Original release date: 2010-08-24
Authors: Davidson, Amy; Patora-Komisarska, Krystyna; Robinson, John; Varani, Gabriele
Citation: Davidson, Amy; Patora-Komisarska, Krystyna; Robinson, John; Varani, Gabriele. "Essential structural requirements for specific recognition of HIV TAR RNA by peptide mimetics of Tat protein." Nucleic Acids Res. 39, 248-256 (2011).
Assembly members:
HIV-1_TAR/KP-Z-41, polymer, 29 residues, 11193.474 Da.
peptide, polymer, 18 residues, Formula weight is not available
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: virus Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
HIV-1_TAR/KP-Z-41: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
peptide: RVRCRQRKGRRICIRIXP
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 275 |