BMRB Entry 17106
Click here to enlarge.
PDB ID: 2l1v
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17106
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: solution structure of a preQ1 riboswitch (Class I) aptamer bound to preQ1 PubMed: 19285444
Deposition date: 2010-08-06 Original release date: 2010-08-19
Authors: Kang, Mijeong; Zhang, Qi; Feigon, Juli
Citation: Kang, Mijeong; Zhang, Qi; Peterson, Robert; Feigon, Juli. "Structural Insights into Riboswitch Control of the Biosynthesis of Queuosine, a Modified Nucleotide Found in the Anticodon of tRNA" Mol. Cell 33, 784-790 (2009).
Assembly members:
RNA_(36-MER), polymer, 36 residues, 11527.992 Da.
PRF, non-polymer, 179.179 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(36-MER): GGAGAGGUUCUAGUUAUACC
CUCUAUAAAAAACUAA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 229 |
| 15N chemical shifts | 67 |
| 1H chemical shifts | 319 |