BMRB Entry 17129
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17129
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer. PubMed: 22129448
Deposition date: 2010-08-14 Original release date: 2012-05-22
Authors: Herve du Penhoat, Catherine; Hantz, Edith; Missailidis, Sotiris; Piotto, Martial; Cognet, Jean; Baouendi, Meriem
Citation: Baouendi, Meriem; Cognet, Jean; Ferreira, Catia; Missailidis, Sotiris; Coutant, Jerome; Piotto, Martial; Hantz, Edith; Herve du Penhoat, Catherine. "Solution structure of a truncated anti-MUC1 DNA aptamer determined by mesoscale modeling and NMR." FEBS J. 279, 479-490 (2012).
Assembly members:
25-mer_oligodeoxyribonucleotide, polymer, 25 residues, 8147.2 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
25-mer_oligodeoxyribonucleotide: GCAGTTGATCCTTTGGATAC
CCTGG
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 139 |
| 1H chemical shifts | 254 |
| 31P chemical shifts | 25 |