BMRB Entry 17188
Click here to enlarge.
PDB ID: 2l3e
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17188
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of P2a-J2a/b-P2b of human telomerase RNA PubMed: 20966348
Deposition date: 2010-09-13 Original release date: 2010-10-26
Authors: Zhang, Qi; Kim, Nak-Kyoon; Peterson, Robert; Wang, Zhonghua; Feigon, Juli
Citation: Zhang, Qi; Kim, Nak-Kyoon; Peterson, Robert; Wang, Zhonghua; Feigon, Juli. "Inaugural Article: Structurally conserved five nucleotide bulge determines the overall topology of the core domain of human telomerase RNA." Proc. Natl. Acad. Sci. U.S.A. 107, 18761-18768 (2010).
Assembly members:
RNA_35-MER, polymer, 35 residues, 11164.710 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: reverse transcriptase
Entity Sequences (FASTA):
RNA_35-MER: GGCUUUUGCUCCCCGUGCUU
CGGCACGGAAAAGCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 235 |
15N chemical shifts | 61 |
1H chemical shifts | 309 |