BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17188

Title: Solution structure of P2a-J2a/b-P2b of human telomerase RNA   PubMed: 20966348

Deposition date: 2010-09-13 Original release date: 2010-10-26

Authors: Zhang, Qi; Kim, Nak-Kyoon; Peterson, Robert; Wang, Zhonghua; Feigon, Juli

Citation: Zhang, Qi; Kim, Nak-Kyoon; Peterson, Robert; Wang, Zhonghua; Feigon, Juli. "Inaugural Article: Structurally conserved five nucleotide bulge determines the overall topology of the core domain of human telomerase RNA."  Proc. Natl. Acad. Sci. U.S.A. 107, 18761-18768 (2010).

Assembly members:
RNA_35-MER, polymer, 35 residues, 11164.710 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: reverse transcriptase

Entity Sequences (FASTA):
RNA_35-MER: GGCUUUUGCUCCCCGUGCUU CGGCACGGAAAAGCC

Data sets:
Data typeCount
13C chemical shifts235
15N chemical shifts61
1H chemical shifts309

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all