BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17292

Title: NMR structure of the A730 loop of the Neurospora VS ribozyme   PubMed: 21266483

Deposition date: 2010-11-11 Original release date: 2011-01-27

Authors: Desjardins, Genevieve; Bonneau, Eric; Girard, Nicolas; Boisbouvier, Jerome; Legault, Pascale

Citation: Desjardins, Genevieve; Bonneau, Eric; Girard, Nicolas; Boisbouvier, Jerome; Legault, Pascale. "NMR structure of the A730 loop of the Neurospora VS ribozyme: insights into the formation of the active site."  Nucleic Acids Res. 39, 4427-4437 (2011).

Assembly members:
VS_ribozyme_SVI_RNA_(26-MER), polymer, 26 residues, 8421.162 Da.

Natural source:   Common Name: Neurospora   Taxonomy ID: 5140   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora not available

Experimental source:   Production method: enzymatic synthesis

Entity Sequences (FASTA):
VS_ribozyme_SVI_RNA_(26-MER): GAGCUGCAGCACGAAAGUGA CGGCUC

Data sets:
Data typeCount
13C chemical shifts173
15N chemical shifts91
1H chemical shifts232

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all