BMRB Entry 17292
Click here to enlarge.
PDB ID: 2l5z
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17292
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of the A730 loop of the Neurospora VS ribozyme PubMed: 21266483
Deposition date: 2010-11-11 Original release date: 2011-01-27
Authors: Desjardins, Genevieve; Bonneau, Eric; Girard, Nicolas; Boisbouvier, Jerome; Legault, Pascale
Citation: Desjardins, Genevieve; Bonneau, Eric; Girard, Nicolas; Boisbouvier, Jerome; Legault, Pascale. "NMR structure of the A730 loop of the Neurospora VS ribozyme: insights into the formation of the active site." Nucleic Acids Res. 39, 4427-4437 (2011).
Assembly members:
VS_ribozyme_SVI_RNA_(26-MER), polymer, 26 residues, 8421.162 Da.
Natural source: Common Name: Neurospora Taxonomy ID: 5140 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Neurospora not available
Experimental source: Production method: enzymatic synthesis
Entity Sequences (FASTA):
VS_ribozyme_SVI_RNA_(26-MER): GAGCUGCAGCACGAAAGUGA
CGGCUC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 173 |
15N chemical shifts | 91 |
1H chemical shifts | 232 |