BMRB Entry 17316
Click here to enlarge.
PDB ID: 2kzl
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17316
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Specifier domain and GA motif region of B. subtilis tyrS T box leader RNA PubMed: 21333656
Deposition date: 2010-11-23 Original release date: 2011-02-22
Authors: Wang, Jiachen
Citation: Wang, Jiachen; Nikonowicz, Edward. "Solution Structure of the K-Turn and Specifier Loop Domains from the Bacillus subtilis tyrS T-Box Leader RNA." J. Mol. Biol. 408, 99-117 (2011).
Assembly members:
Specifier_Domain_and_GA_motif_region_of_B._subtilis_tyrS_T_box_leader_RNA, polymer, 55 residues, 244.204 Da.
Natural source: Common Name: firmicutes Taxonomy ID: 1423 Superkingdom: Bacteria Kingdom: not available Genus/species: Bacillus subtilis
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Specifier_Domain_and_GA_motif_region_of_B._subtilis_tyrS_T_box_leader_RNA: GGGAGUAAAGAUUGAGACAA
GUAGGACUUCGGUCCGAAUA
CACUCAUGAACUCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 347 |
| 15N chemical shifts | 18 |
| 1H chemical shifts | 408 |