BMRB Entry 17379
Click here to enlarge.
PDB ID: 2l7v
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17379
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: QUI/G-quadruplex complex PubMed: 21967482
Deposition date: 2010-12-23 Original release date: 2011-10-12
Authors: Dai, Jixun; Carver, Megan; Mathad, Ravi; Yang, Danzhou
Citation: Dai, Jixun; Carver, Megan; Hurley, Laurence; Yang, Danzhou. "Solution structure of a 2:1 quindoline-c-MYC G-quadruplex: insights into G-quadruplex-interactive small molecule drug design." J. Am. Chem. Soc. 133, 17673-17680 (2011).
Assembly members:
DNA_(5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')_, polymer, 22 residues, 7008.566 Da.
QUI, non-polymer, 174.156 Da.
K, non-polymer, 39.098 Da.
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')_: TGAGGGTGGGTAGGGTGGGT
AA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 208 |