BMRB Entry 17397
Click here to enlarge.
PDB ID: 2l88
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17397
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence PubMed: 21540209
Deposition date: 2011-01-06 Original release date: 2011-05-12
Authors: Tong, Xiaotian; Cao, Chunyang
Citation: Tong, Xiaotian; Lan, Wenxian; Zhang, Xu; Wu, Houming; Liu, Maili; Cao, Chunyang. "Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence." Nucleic Acids Res. 39, 6753-6763 (2011).
Assembly members:
RET_oncogene, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis Host organism: Escherichia coli
Entity Sequences (FASTA):
RET_oncogene: GGGGCGGGGCGGGGCGGGGT
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 209 |