BMRB Entry 17408
Click here to enlarge.
PDB ID: 2l8h
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17408
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Chemical probe bound to HIV TAR RNA PubMed: 21763501
Deposition date: 2011-01-12 Original release date: 2012-08-14
Authors: Davidson, Amy; Begley, Darren; Lau, Carmen; Varani, Gabriele
Citation: Davidson, Amy; Begley, Darren; Lau, Carmen; Varani, Gabriele. "A small-molecule probe induces a conformation in HIV TAR RNA capable of binding drug-like fragments" J. Mol. Biol. 410, 984-996 (2011).
Assembly members:
HIV_TAR_RNA, polymer, 29 residues, 132.116 Da.
ARG, non-polymer, 175.209 Da.
L8H, non-polymer, 173.211 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
HIV_TAR_RNA: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 177 |