BMRB Entry 17436
Click here to enlarge.
PDB ID: 2l94
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17436
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication PubMed: 21648432
Deposition date: 2011-01-29 Original release date: 2011-06-16
Authors: Marcheschi, Ryan; Tonelli, Marco; Kumar, Arvind; Butcher, Samuel
Citation: Marcheschi, Ryan; Tonelli, Marco; Kumar, Arvind; Butcher, Samuel. "Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication." ACS Chem. Biol. 6, 857-864 (2011).
Assembly members:
RNA_(45-MER), polymer, 45 residues, 14519.805 Da.
L94, non-polymer, 336.519 Da.
Natural source: Common Name: Human immunodeficiency virus Taxonomy ID: 12721 Superkingdom: not available Kingdom: virus Genus/species: Lentivirus not available
Experimental source: Production method: in vitro transcription Host organism: E. coli - cell free
Entity Sequences (FASTA):
RNA_(45-MER): GGGAAGAUCUGGCCUUCCCA
CAAGGGAAGGCCAGGGAAUC
UUCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 76 |
| 1H chemical shifts | 363 |