BMRB Entry 17504
Click here to enlarge.
PDB ID: 2la5
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_anomalous, AVS_full
BMRB Entry DOI: doi:10.13018/BMR17504
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide PubMed: 21642970
Deposition date: 2011-03-03 Original release date: 2011-06-07
Authors: Phan, Anh Tuan; Kuryavyi, Vitaly V; Darnell, Jennifer C; Serganov, Alexander; Majumdar, Ananya; Ilin, Serge; Darnell, Robert B; Patel, Dinshaw J
Citation: Phan, Anh Tuan; Kuryavyi, Vitaly; Darnell, Jennifer; Serganov, Alexander; Majumdar, Ananya; Ilin, Serge; Raslin, Tanya; Polonskaia, Anna; Chen, Cynthia; Clain, David; Darnell, Robert; Patel, Dinshaw. "Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction." Nat. Struct. Mol. Biol. 18, 796-804 (2011).
Assembly members:
RNA_(36-MER), polymer, 36 residues, 11805.102 Da.
entity_2, polymer, 17 residues, 1757.934 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(36-MER): GCUGCGGUGUGGAAGGAGUG
GCUGGGUUGCGCAGCG
entity_2: GPRRGDGRRRGGGGRGQ
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 410 |