BMRB Entry 17574
Click here to enlarge.
PDB ID: 2lbs
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR17574
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of a yeast RNase III dsRBD complex with a non-canonical RNA substrate provides new insights into substrate recognition
Deposition date: 2011-04-06 Original release date: 2011-08-03
Authors: Wang, Zhonghua; Hartman, Elon; Roy, Kevin; Chanfreau, Guillaume; Feigon, Juli
Citation: Wang, Zhonghua; Hartman, Elon; Roy, Kevin; Chanfreau, Guillaume; Feigon, Juli. "Structure of a yeast RNase III dsRBD complex with a non-canonical RNA substrate provides new insights into substrate recognition" Not known ., .-..
Assembly members:
yeast RNase III dsRBD, polymer, 90 residues, 9822.442 Da.
non-canonical RNA substrate, polymer, 32 residues, Formula weight is not available
Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
yeast RNase III dsRBD: GSLDMNAKRQLYSLIGYASL
RLHYVTVKKPTAVDPNSIVE
CRVGDGTVLGTGVGRNIKIA
GIRAAENALRDKKMLDFYAK
QRAAIPRSES
non-canonical RNA substrate: GGGAUACCAUGUUCAAGUGA
ACGUGGUAUCUC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 326 |
15N chemical shifts | 87 |
1H chemical shifts | 547 |
Additional metadata:
Related Database Links:
BMRB | 18534 18535 |
PDB | 1T4L 1T4N 1T4O 2LBS 2LUP 2LUQ 4OOG |
DBJ | GAA25690 |
EMBL | CAA90210 CAY82070 |
GB | AAB04172 AHY76694 AJP40933 AJS62105 AJS62540 |
REF | NP_013966 |
SP | Q02555 |
TPG | DAA10139 |
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts