BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17601

Title: Solution structure of the MLV readthrough pseudoknot   PubMed: 22121021

Deposition date: 2011-04-26 Original release date: 2011-12-02

Authors: Houck-Loomis, Brian; Durney, Michael; D'Souza, Victoria

Citation: Houck-Loomis, Brian; Durney, Michael; Salguero, Carolina; Shankar, Neelaabh; Nagle, Julia; Goff, Stephen. "An equilibrium-dependent retroviral mRNA switch regulates translational recoding."  Nature 480, 561-564 (2011).

Assembly members:
RNA_(59-MER), polymer, 63 residues, 111.103 Da.

Natural source:   Common Name: MMLV   Taxonomy ID: 11801   Superkingdom: Viruses   Kingdom: not available   Genus/species: not available murine leukemia virus

Experimental source:   Production method: recombinant technology   Host organism: None: in vitro transcription

Entity Sequences (FASTA):
RNA_(59-MER): GGAGGUCAGGGUCAGGAGCC CCCCCCUGAACCCAGGAUAA CCCUCAAAGUCGGGGGGCAA CCC

Data sets:
Data typeCount
13C chemical shifts92
1H chemical shifts182

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all