BMRB Entry 17601
Click here to enlarge.
PDB ID: 2lc8
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17601
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the MLV readthrough pseudoknot PubMed: 22121021
Deposition date: 2011-04-26 Original release date: 2011-12-02
Authors: Houck-Loomis, Brian; Durney, Michael; D'Souza, Victoria
Citation: Houck-Loomis, Brian; Durney, Michael; Salguero, Carolina; Shankar, Neelaabh; Nagle, Julia; Goff, Stephen. "An equilibrium-dependent retroviral mRNA switch regulates translational recoding." Nature 480, 561-564 (2011).
Assembly members:
RNA_(59-MER), polymer, 63 residues, 111.103 Da.
Natural source: Common Name: MMLV Taxonomy ID: 11801 Superkingdom: Viruses Kingdom: not available Genus/species: not available murine leukemia virus
Experimental source: Production method: recombinant technology Host organism: None: in vitro transcription
Entity Sequences (FASTA):
RNA_(59-MER): GGAGGUCAGGGUCAGGAGCC
CCCCCCUGAACCCAGGAUAA
CCCUCAAAGUCGGGGGGCAA
CCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 92 |
1H chemical shifts | 182 |