BMRB Entry 17860
Click here to enlarge.
PDB ID: 2lhp
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17860
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: high resolution NMR solution structure of helix H1 of the chimpanzee HAR1 RNA PubMed: 22961937
Deposition date: 2011-08-12 Original release date: 2012-07-24
Authors: Cevec, Mirko; Ziegeler, Melanie; Richter, Christian; Schwalbe, Harald
Citation: Ziegeler, Melanie; Cevec, Mirko; Richter, Christian; Schwalbe, Harald. "NMR Studies of HAR1 RNA Secondary Structures Reveal Conformational Dynamics in the Human RNA" Chembiochem 13, 2100-2112 (2012).
Assembly members:
RNA_(37-MER), polymer, 37 residues, 11872.162 Da.
Natural source: Common Name: chimpanzee Taxonomy ID: 9598 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Pan troglodytes
Experimental source: Production method: chemical synthesis Host organism: Escherichia coli
Entity Sequences (FASTA):
RNA_(37-MER): GGGUGAAAUGGAGGACUUCG
GUCCUCAAAUUUCACCC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 282 |