BMRB Entry 17877
Click here to enlarge.
PDB ID: 2li4
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17877
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of a shortened antiterminator hairpin from a Mg2+ riboswitch PubMed: 22976989
Deposition date: 2011-08-22 Original release date: 2012-08-22
Authors: Korth, Maximiliane; Sigel, Roland
Citation: Korth, Maximiliane; Sigel, Roland. "Unusually high-affinity Mg(2+) binding at the AU-rich sequence within the antiterminator hairpin of a Mg(2+) riboswitch." Chem. Biodivers. 9, 2035-2049 (2012).
Assembly members:
RNA_(32-MER), polymer, 32 residues, 10304.251 Da.
Natural source: Common Name: Yersinia enterocolitica Taxonomy ID: 630 Superkingdom: Bacteria Kingdom: not available Genus/species: Yersinia enterocolitica
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
RNA_(32-MER): GGACCGAUAAGGUAGAAAUG
CCUUAUCGGUCC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 232 |