BMRB Entry 17961
Click here to enlarge.
PDB ID: 2lkr
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17961
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: S. cerevisiae U2/U6 snRNA complex PubMed: 22328579
Deposition date: 2011-09-26 Original release date: 2012-02-12
Authors: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel
Citation: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel. "Structure of the yeast U2/U6 snRNA complex." RNA 18, 673-683 (2012).
Assembly members:
U2U6111, polymer, 111 residues, Formula weight is not available
Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: cell free synthesis Host organism: E. coli - cell free
Entity Sequences (FASTA):
U2U6111: GGCAAUACAGAGAUGAUCAG
CAGUUCCCCUGCAUAAGGAU
GAACCGUUUUACAAAGAGAU
UUCUUCGGGAAUCUCUUUGC
CUUUUGGCUUAGAUCAAGUG
UAGUAUCUGUC
Data type | Count |
15N chemical shifts | 54 |
1H chemical shifts | 140 |