BMRB Entry 17972
Click here to enlarge.
PDB ID: 2lk3
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17972
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: U2/U6 Helix I PubMed: 22328579
Deposition date: 2011-10-03 Original release date: 2012-02-20
Authors: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel
Citation: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel. "Structure of the yeast U2/U6 snRNA complex." RNA 18, 673-683 (2012).
Assembly members:
RNA_(5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP*AP*GP*AP*AP*AP*UP*GP*AP*UP*CP*AP*GP*CP*C)-3')_, polymer, 24 residues, 7716.717 Da.
Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: cell free synthesis Host organism: E. coli - cell free
Entity Sequences (FASTA):
RNA_(5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP*AP*GP*AP*AP*AP*UP*GP*AP*UP*CP*AP*GP*CP*C)-3')_: GGCUUAGAUCAGAAAUGAUC
AGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 80 |
| 1H chemical shifts | 167 |