BMRB Entry 18034
Click here to enlarge.
PDB ID: 4a4t
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18034
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops PubMed: 22605553
Deposition date: 2011-11-01 Original release date: 2012-05-22
Authors: Zhao, Q.; Huang, H.; Nagaswamy, U.; Xia, Y.; Gao, X.; Fox, George
Citation: Zhao, Qin; Huang, Hung-Chung; Nagaswamy, Uma; Xia, Youlin; Gao, Xiaolian; Fox, George. "UNAC tetraloops: to what extent do they mimic GNRA tetraloops?" Biopolymers 97, 617-628 (2012).
Assembly members:
UUAC, polymer, 22 residues, 7093.14882 Da.
Natural source: Common Name: Haloarcula marismortui Taxonomy ID: 2238 Superkingdom: Archaea Kingdom: not available Genus/species: Haloarcula marismortui
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
UUAC: GGACCCGGCUUACGCUGGGU
CC
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 89 |