BMRB Entry 18209
Click here to enlarge.
PDB ID: 2lod
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18209
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops PubMed: 22532609
Deposition date: 2012-01-23 Original release date: 2012-05-08
Authors: Marusic, Maja; Sket, Primoz; Bauer, Lubos; Viglasky, Viktor; Plavec, Janez
Citation: Marusic, Maja; Sket, Primoz; Bauer, Lubos; Viglasky, Viktor; Plavec, Janez. "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops." Nucleic Acids Res. 40, 6946-6956 (2012).
Assembly members:
DNA_molecule_G3ATG3ACACAG4ACG3, polymer, 22 residues, 6972.544 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_molecule_G3ATG3ACACAG4ACG3: GGGATGGGACACAGGGGACG
GG
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 153 |