BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18209

Title: Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops   PubMed: 22532609

Deposition date: 2012-01-23 Original release date: 2012-05-08

Authors: Marusic, Maja; Sket, Primoz; Bauer, Lubos; Viglasky, Viktor; Plavec, Janez

Citation: Marusic, Maja; Sket, Primoz; Bauer, Lubos; Viglasky, Viktor; Plavec, Janez. "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops."  Nucleic Acids Res. 40, 6946-6956 (2012).

Assembly members:
DNA_molecule_G3ATG3ACACAG4ACG3, polymer, 22 residues, 6972.544 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_molecule_G3ATG3ACACAG4ACG3: GGGATGGGACACAGGGGACG GG

Data sets:
Data typeCount
1H chemical shifts153

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all