BMRB Entry 18336
Click here to enlarge.
PDB ID: 2lqz
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18336
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of the RNA claw of the DNA packaging motor of bacteriophage 29 PubMed: 22879380
Deposition date: 2012-03-19 Original release date: 2012-07-30
Authors: Harjes, Elena; Matsuo, Hiroshi; Kitamura, Aya
Citation: Harjes, Elena; Kitamura, Aya; Zhao, Wei; Morais, Marc; Jardine, Paul; Grimes, Shelley; Matsuo, Hiroshi. "Structure of the RNA claw of the DNA packaging motor of bacteriophage 29." Nucleic Acids Res. 40, 9953-9963 (2012).
Assembly members:
RNA_(27-MER), polymer, 27 residues, 8586.186 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: Phi 29
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
RNA_(27-MER): GGACUUCCAUUGCUUCGGCA
AAAGUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 69 |
| 15N chemical shifts | 9 |
| 1H chemical shifts | 209 |