BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18503

Title: NMR solution structure of the kappa-zeta region of S.cerevisiae group II intron ai5(gamma)   PubMed: 23275550

Deposition date: 2012-06-05 Original release date: 2013-02-14

Authors: Donghi, Daniela; Pechlaner, Maria; Finazzo, Cinzia; Knobloch, Bernd; Sigel, Roland

Citation: Donghi, Daniela; Pechlaner, Maria; Finazzo, Cinzia; Knobloch, Bernd; Sigel, Roland. "The structural stabilization of the three-way junction by Mg(II) represents the first step in the folding of a group II intron."  Nucleic Acids Res. 41, 2489-2504 (2013).

Assembly members:
RNA_(49-MER), polymer, 49 residues, 15800.554 Da.

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: cell free synthesis   Host organism: cell free synthesis (using T7 polymerase)

Entity Sequences (FASTA):
RNA_(49-MER): GGAAUAUGCUCAACGAAAGU GAAUCAGCUUCGGCUGAGAG CUAAGUUCC

Data sets:
Data typeCount
13C chemical shifts312
15N chemical shifts95
1H chemical shifts550

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all