BMRB Entry 18532
Click here to enlarge.
PDB ID: 2lun
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18532
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: RNA Aptamer for B. anthracis Ribosomal Protein S8
Deposition date: 2012-06-18 Original release date: 2013-12-16
Authors: Nikonowicz, Edward; Wang, Jiachen
Citation: Donarski, James; Wang, Jiachen; Nikonowicz, Edward. "An RNA Aptamer Takes an Unexpected Twist to Bind r-Protein S8" Unknown ., .-..
Assembly members:
RNA, polymer, 28 residues, 111.103 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA: GGGCAGUGAUGCUUCGGCAU
AUCAGCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 201 |
| 15N chemical shifts | 65 |
| 1H chemical shifts | 195 |