BMRB Entry 18549
Click here to enlarge.
PDB ID: 2lv0
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18549
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA
Deposition date: 2012-06-26 Original release date: 2013-06-24
Authors: Nikonowicz, Edward; Wang, Jiachen; Moran, Sean; Donarski, James
Citation: Moran, Sean; Donarski, James; Wang, Jiachen; Nikonowicz, Edward. "Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA" Not known ., .-..
Assembly members:
RNA, polymer, 24 residues, 132.116 Da.
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA: GGGCUAAUGUUGAAAAAUUA
GCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 181 |
| 15N chemical shifts | 42 |
| 1H chemical shifts | 185 |