BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18838

Title: Solution structure of the ID3 stem loop of domain 1 in the ai5gamma group II intron   PubMed: 24243113

Deposition date: 2012-11-13 Original release date: 2013-10-21

Authors: Popovic, Milena; Greenbaum, Nancy

Citation: Popovic, Milena; Greenbaum, Nancy. "Role of helical constraints of the EBS1-IBS1 duplex of a group II intron on demarcation of the 5' splice site."  RNA 20, 24-35 (2014).

Assembly members:
ID3, polymer, 23 residues, 132.116 Da.

Natural source:   Common Name: Baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
ID3: GGGUGUAUUGGAAAUGAGCA CCC

Data sets:
Data typeCount
13C chemical shifts132
1H chemical shifts158

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all