BMRB Entry 18838
Click here to enlarge.
PDB ID: 2m12
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18838
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the ID3 stem loop of domain 1 in the ai5gamma group II intron PubMed: 24243113
Deposition date: 2012-11-13 Original release date: 2013-10-21
Authors: Popovic, Milena; Greenbaum, Nancy
Citation: Popovic, Milena; Greenbaum, Nancy. "Role of helical constraints of the EBS1-IBS1 duplex of a group II intron on demarcation of the 5' splice site." RNA 20, 24-35 (2014).
Assembly members:
ID3, polymer, 23 residues, 132.116 Da.
Natural source: Common Name: Baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: enzymatic semisynthesis Host organism: Saccharomyces cerevisiae
Entity Sequences (FASTA):
ID3: GGGUGUAUUGGAAAUGAGCA
CCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 132 |
1H chemical shifts | 158 |