BMRB Entry 18891
Click here to enlarge.
PDB ID: 2m21
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18891
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop PubMed: 16809815
Deposition date: 2012-12-11 Original release date: 2013-01-24
Authors: Cash, Darian; Richards, Rebecca; Wu, Haihong; Trantirek, Lukas; O'Connor, Catherine; Feigon, Juli; Collins, Kathleen
Citation: Richards, Rebecca; Wu, Haihong; Trantirek, Lukas; O'Connor, Catherine; Collins, Kathleen; Feigon, Juli. "Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop" RNA 12, 1475-1485 (2006).
Assembly members:
stemIV_telo_RNA, polymer, 21 residues, 6650.027 Da.
Natural source: Common Name: tetrahymena thermophila Taxonomy ID: 5911 Superkingdom: Eukaryota Kingdom: not available Genus/species: tetrahymena thermophila
Experimental source: Production method: enzymatic synthesis Host organism: n/a
Entity Sequences (FASTA):
stemIV_telo_RNA: GGCGAUACACUAUUUAUCGC
C
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 141 |
| 15N chemical shifts | 19 |
| 1H chemical shifts | 181 |