BMRB Entry 18892
Click here to enlarge.
PDB ID: 2m22
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18892
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA PubMed: 16452301
Deposition date: 2012-12-11 Original release date: 2013-01-24
Authors: Cash, Darian; Richards, Rebecca; Theimer, Carla; Finger, David; Feigon, Juli
Citation: Richards, Rebecca; Theimer, Carla; Finger, David; Feigon, Juli. "Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA" Nucleic Acids Res. 34, 816-825 (2006).
Assembly members:
helixII_telo_RNA, polymer, 23 residues, 7387.508 Da.
Natural source: Common Name: tetrahymena thermophila Taxonomy ID: 5911 Superkingdom: Eukaryota Kingdom: not available Genus/species: tetrahymena thermophila
Experimental source: Production method: enzymatic synthesis Host organism: n/a
Entity Sequences (FASTA):
helixII_telo_RNA: GGCAGAUCUGUAAUAGAACU
GCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 151 |
| 15N chemical shifts | 34 |
| 1H chemical shifts | 184 |