BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18894

Title: NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma   PubMed: 24448450

Deposition date: 2012-12-12 Original release date: 2013-12-16

Authors: Kruschel, Daniela; Skilandat, Miriam; Sigel, Roland

Citation: Kruschel, Daniela; Skilandat, Miriam; Sigel, Roland. "NMR structure of the 5'-splice site in the group IIB intron Sc.ai5--conformational requirements for exon-intron recognition."  RNA ., .-. (2014).

Assembly members:
RNA_(29-MER), polymer, 29 residues, 9301.611 Da.

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: cell free synthesis   Host organism: not applicable

Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA GCAUACUCC

Data sets:
Data typeCount
13C chemical shifts102
15N chemical shifts18
1H chemical shifts223

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (29-MER)1

Entities:

Entity 1, RNA (29-MER) 29 residues - 9301.611 Da.

part of intron domain one; postion 5-25 correspond to 315-335 on intron (25657-25677 on gene); extended by 4 nt on each side

1   GGAGUAUGUA
2   UUGGCACUGA
3   GCAUACUCC

Samples:

unlabelled_d2o: RNA (29-MER)0.4 – 1.2 mM; potassium chloride 10 mM; EDTA 10 uM; D2O 100%

unlabelled_h2o: RNA (29-MER)0.4 – 1.2 mM; potassium chloride 10 mM; EDTA 10 uM; D2O 10%; H2O 90%

labelled_h2o: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.7 mM; potassium chloride 10 mM; EDTA 10 uM; D2O 10%; H2O 90%

labelled_h2o_phage: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.7 mM; potassium chloride 10 mM; EDTA 10 uM; Pf1 phage 25.6 mg/mL; D2O 10%; H2O 90%

labelled_d2o: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.7 mM; potassium chloride 10 mM; EDTA 10 uM; D2O 100%

deuterated_d2o: RNA (29-MER), [3, $RNA_(29-MER) 0.6; 18894, 6, 10; 18894, 6, 10; 18894, 6, 100; 18894, 6,

h2o_293K: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 293 K

d2o_293K: ionic strength: 10 mM; pD: 6.8; pressure: 1 atm; temperature: 293 K

h2o_278K: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K

h2o_298K: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

d2o_298K: ionic strength: 10 mM; pD: 6.8; pressure: 1 atm; temperature: 298 K

d2o_283K: ionic strength: 10 mM; pD: 6.8; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYunlabelled_d2oisotropicd2o_293K
2D 1H-1H TOCSYunlabelled_d2oisotropicd2o_293K
2D 1H-1H NOESYunlabelled_d2oisotropicd2o_293K
2D 1H-1H NOESYunlabelled_h2oisotropich2o_278K
2D 1H-1H NOESYunlabelled_h2oisotropich2o_278K
2D 1H-13C HSQC aliphaticlabelled_h2oisotropich2o_298K
2D 1H-13C HSQC aromaticlabelled_h2oisotropich2o_298K
2D 1H-15N HSQClabelled_h2oisotropich2o_278K
2D 1H-13C HSQC aliphaticlabelled_h2o_phageanisotropich2o_298K
2D 1H-13C HSQC aromaticlabelled_h2o_phageanisotropich2o_298K
2D JNN HNN COSYlabelled_h2oisotropich2o_278K
2D 1H-1H NOESYunlabelled_d2oisotropicd2o_283K
2D 1H-1H NOESYunlabelled_d2oisotropicd2o_298K
1D 31Punlabelled_d2oisotropicd2o_293K
2D 1H-1H NOESYdeuterated_d2oisotropicd2o_293K

Software:

TOPSPIN v1.3, 2.0, 2.1, Bruker Biospin - collection, processing

SPARKY v3.1, Goddard - chemical shift assignment, data analysis, peak picking

DYANA v1.5, Guntert, Braun and Wuthrich - data analysis

CNSSOLVE v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure solution

X-PLOR NIH v2.24, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 500 MHz