BMRB Entry 18894

Name: NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma
Published: 2013-12-16

Click here to enlarge.

PDB ID: 2m24
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18894
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title: NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma PubMed: 24448450

Deposition date: 2012-12-12 Original release date: 2013-12-16

Authors: Kruschel, Daniela; Skilandat, Miriam; Sigel, Roland

Citation: Kruschel, Daniela; Skilandat, Miriam; Sigel, Roland. "NMR structure of the 5'-splice site in the group IIB intron Sc.ai5--conformational requirements for exon-intron recognition." RNA ., .-. (2014).

Assembly members:
RNA_(29-MER), polymer, 29 residues, 9301.611 Da.

Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi

Experimental source: Production method: cell free synthesis Host organism: not applicable

Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA GCAUACUCC

Data sets:

assigned_chemical_shifts
- assigned_chem_shift_list_1

Data type	Count
13C chemical shifts	102
15N chemical shifts	18
1H chemical shifts	223

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Name	Sample	Sample state	Sample conditions
2D 1H-1H NOESY	unlabelled_d2o	isotropic	d2o_293K
2D 1H-1H TOCSY	unlabelled_d2o	isotropic	d2o_293K
2D 1H-1H NOESY	unlabelled_d2o	isotropic	d2o_293K
2D 1H-1H NOESY	unlabelled_h2o	isotropic	h2o_278K
2D 1H-1H NOESY	unlabelled_h2o	isotropic	h2o_278K
2D 1H-13C HSQC aliphatic	labelled_h2o	isotropic	h2o_298K
2D 1H-13C HSQC aromatic	labelled_h2o	isotropic	h2o_298K
2D 1H-15N HSQC	labelled_h2o	isotropic	h2o_278K
2D 1H-13C HSQC aliphatic	labelled_h2o_phage	anisotropic	h2o_298K
2D 1H-13C HSQC aromatic	labelled_h2o_phage	anisotropic	h2o_298K
2D JNN HNN COSY	labelled_h2o	isotropic	h2o_278K
2D 1H-1H NOESY	unlabelled_d2o	isotropic	d2o_283K
2D 1H-1H NOESY	unlabelled_d2o	isotropic	d2o_298K
1D 31P	unlabelled_d2o	isotropic	d2o_293K
2D 1H-1H NOESY	deuterated_d2o	isotropic	d2o_293K

Biological Magnetic Resonance Data Bank

BMRB Entry 18894

Title: NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma PubMed: 24448450

Additional metadata:

Assembly:

Entities:

Samples:

Experiments:

Software:

NMR spectrometers: