BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19018

Title: NMR structure of E. coli ribosomela decoding site with apramycin   PubMed: 23416053

Deposition date: 2013-02-10 Original release date: 2013-03-13

Authors: Puglisi, Joseph; Tsai, Albert; Marshall, R. Andrew; Viani, Elisabetta

Citation: Tsai, Albert; Uemura, Sotaro; Johansson, Magnus; Puglisi, Elisabetta Viani; Marshall, R. Andrew; Aitken, Colin Echeverria; Korlach, Jonas; Ehrenberg, Mans; Puglisi, Joseph. "The impact of aminoglycosides on the dynamics of translation elongation."  Cell Rep. 3, 497-508 (2013).

Assembly members:
RNA, polymer, 27 residues, 132.116 Da.
APRAMYCIN, non-polymer, 539.577 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA: GGCGUCACACCUUCGGGUGA AGUCGCC

Data sets:
Data typeCount
13C chemical shifts256
15N chemical shifts101
1H chemical shifts262
31P chemical shifts27

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all