BMRB Entry 19039
Click here to enlarge.
PDB ID: 2m57
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19039
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR solution structure of domain 5 from Azotobacter vinelandii Intron 5 at pH 7.8
Deposition date: 2013-02-15 Original release date: 2014-02-24
Authors: Pechlaner, Maria; Donghi, Daniela; Zelenay, Veronika; Sigel, Roland K. O.
Citation: Pechlaner, Maria; Donghi, Daniela; Zelenay, Veronika; Sigel, Roland K. O.. "Acid-base equilibria near neutral pH in the catalytic triad and the bulge of domain 5 of a bacterial group II intron" Not known ., .-..
Assembly members:
RNA_(35-MER), polymer, 35 residues, 11268.784 Da.
Natural source: Common Name: Azotobacter vinelandii Taxonomy ID: 354 Superkingdom: Bacteria Kingdom: not available Genus/species: Azotobacter vinelandii
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
RNA_(35-MER): GGAGCCGUAUGCGGUAGUUC
CGCACGUACGGAUCU
Data type | Count |
13C chemical shifts | 216 |
15N chemical shifts | 95 |
1H chemical shifts | 569 |