BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19039

Title: NMR solution structure of domain 5 from Azotobacter vinelandii Intron 5 at pH 7.8

Deposition date: 2013-02-15 Original release date: 2014-02-24

Authors: Pechlaner, Maria; Donghi, Daniela; Zelenay, Veronika; Sigel, Roland K. O.

Citation: Pechlaner, Maria; Donghi, Daniela; Zelenay, Veronika; Sigel, Roland K. O.. "Acid-base equilibria near neutral pH in the catalytic triad and the bulge of domain 5 of a bacterial group II intron"  Not known ., .-..

Assembly members:
RNA_(35-MER), polymer, 35 residues, 11268.784 Da.

Natural source:   Common Name: Azotobacter vinelandii   Taxonomy ID: 354   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Azotobacter vinelandii

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
RNA_(35-MER): GGAGCCGUAUGCGGUAGUUC CGCACGUACGGAUCU

Data typeCount
13C chemical shifts216
15N chemical shifts95
1H chemical shifts569

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all