BMRB Entry 19040
Click here to enlarge.
PDB ID: 2m58
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19040
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: structure of 2'-5' AG1 lariat forming ribozyme in its inactive state PubMed: 23472843
Deposition date: 2013-02-18 Original release date: 2013-04-01
Authors: Carlomagno, Teresa; Amata, Irene; Codutti, Luca; Falb, Melanie; Fohrer, Jorg; Simon, Bernd
Citation: Carlomagno, Teresa; Amata, Irene; Codutti, Luca; Falb, Melanie; Fohrer, Jorg; Simon, Bernd. "Structural principles of RNA catalysis in a 2'-5' lariat-forming ribozyme" J. Am. Chem. Soc. 135, 4403-4411 (2013).
Assembly members:
RNA_(59-MER), polymer, 59 residues, 19163.486 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(59-MER): XGAAGAAAGGGCUUCGGCCA
CUCAAACUACAGAGACGCCA
GUCACUCAGAUAUCCUGGU
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 347 |
15N chemical shifts | 12 |
1H chemical shifts | 430 |