BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19040

Title: structure of 2'-5' AG1 lariat forming ribozyme in its inactive state   PubMed: 23472843

Deposition date: 2013-02-18 Original release date: 2013-04-01

Authors: Carlomagno, Teresa; Amata, Irene; Codutti, Luca; Falb, Melanie; Fohrer, Jorg; Simon, Bernd

Citation: Carlomagno, Teresa; Amata, Irene; Codutti, Luca; Falb, Melanie; Fohrer, Jorg; Simon, Bernd. "Structural principles of RNA catalysis in a 2'-5' lariat-forming ribozyme"  J. Am. Chem. Soc. 135, 4403-4411 (2013).

Assembly members:
RNA_(59-MER), polymer, 59 residues, 19163.486 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA_(59-MER): XGAAGAAAGGGCUUCGGCCA CUCAAACUACAGAGACGCCA GUCACUCAGAUAUCCUGGU

Data sets:
Data typeCount
13C chemical shifts347
15N chemical shifts12
1H chemical shifts430

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all