BMRB Entry 19081
Click here to enlarge.
PDB ID: 2m5u
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19081
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of the P4 hairpin of the CPEB3 ribozyme PubMed: 24652468
Deposition date: 2013-03-08 Original release date: 2014-03-31
Authors: Skilandat, Miriam; Rowinska-Zyrek, Magdalena; Sigel, Roland
Citation: Skilandat, Miriam; Rowinska-Zyrek, Magdalena; Sigel, Roland. "Solution structure and metal ion binding sites of the human CPEB3 ribozyme's P4 domain." J. Biol. Inorg. Chem. ., .-. (2014).
Assembly members:
P4_CPEB3, polymer, 22 residues, 7051.259 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
P4_CPEB3: GGCAGAUUCUGGUGAAUCUG
CC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 179 |