BMRB Entry 19402
Click here to enlarge.
PDB ID: 2mbj
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19402
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) PubMed: 23999095
Deposition date: 2013-08-02 Original release date: 2013-09-16
Authors: Lim, Kah Wai; Ng, Veronica Chinn Min; Martin-Pintado, Nerea; Heddi, Brahim; Phan, Anh Tuan
Citation: Lim, Kah Wai; Ng, Veronica Chinn Min; Martin-Pintado, Nerea; Heddi, Brahim; Phan, Anh Tuan. "Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity." Nucleic Acids Res. 41, 10556-10562 (2013).
Assembly members:
DNA_(27-MER), polymer, 27 residues, 8592.441 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(27-MER): TTAGGGTTAGGGTTAGGGTT
AXGGTTA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 229 |